Description :
From Genome Similarity Track
Location :
Scaffold_58:45801- 49646
Transcript NameFunction/comments
Hyaar_Emoy2806984phenylalanyl-tRNA synthetase beta chain
Hyaar_Emoy2806983phenylalanyl-tRNA synthetase beta chain

Sequence
3845 bases(100 bases per row)
CGGCAACGGTGCATGGTCGATACAGCTGCTTTGGCTAGATGTCGCGTCGATTGCTACAACTTCTGTTGCTACTACCATCCGCAAAGCAACGGACGACGAC
GTAATAGTTACGTCAACGAATACTTGTGGAGATAGATTTTTGCATCATACAAAAACCAATGACACAATATCCACACAGAGACATGCACACGCGTAACGTA
GCAAACGTATCAAACCTCATTACCCGACACAATAGCTTGCCATACCGTCCAACACCTGCTGGTCTATTTCGTCCACCTCATGTGGCATCGTCACTTAACT
CACGTCCGTAATTTATCATCCTGGAGATCGGTCTTACAGCAGAGGCTCCAGATCCATCTCTAAAACGGAAGTCGGGTTAAGCAAATCGAAGTTCTTCAGC
ACGCCCGGGTGCAGCACACCGAATGCACCCAAACGCAGAGGCTCAGCATCTTCTTTTTGCAGCACCACGTATGCACAACGGCCGGGAAAGTATGTACGTT
CCTCCGCGGGCGTGATAGTATAGTACTCTTTCGTACCCACAGCCATCTCCAACTCAAACGGAATACCCAGTAGCTGCATAATACGGTCAACAAGACCGTG
AATGACTTCAAACCCGTCGGTTGGGCCGGTGTAGGCAGCGCAAATACGACGCACGTTCTTGGCACCCACGTCTGTTTTGTTGTCGATCACGACAACGTCC
GAGACCTCGAACAACTTCAAACCCTCTTTGATCGACATGGCCTTGTTGTTCTGCAATGTCTTTAGCATACCGGGCAACATCGACGTGCGGACAACCTCAA
ATTCAATCGTGGCCGGGTTCGACAGCACCACAGCCGAGTGACCGTCGTCCTCACGGTTCAAATACTCAAAGTTCTCCTTGTGTGAACACAGGGCGTGAGT
GAGCAGCTCAATGTAGCCAGCACGACTAATCTCATCACGTAGTAGATCGCCCAATTTGTTCAGAGGCTGGGCCATACCGATGGTCTGGGTCTGAGGTATC
GAGAGCGGAATGTTGTTGAAACCGTATGCAATGCCAATATCCTCAATCACATCGACAGGGTGAAGAATATCCGAGCGCGTAATCGGGACCTCTGCAACAA
TAGTCTTTCCGTTGCCAGAAGGCTTGGCGTTCAGCTGCATTTTGTCGCATAGCTTGCACATCCGGTCAATGTCCAGCTCAATCGGCTCGCCCTTGCCAAA
CAGCATTGAATAGACATCCTTGATCGCTACCTCCACCGAACGCGTGCTCAAGTCGGGTGTCATCTCGCTCGCGTTAACACTTTCATCCTCGTAGACCACA
CGCACAGGTTCTACCTTGAAAGGCTTTGCACAGTATTCAGAAAACATGGCGACCATCGCGTTCAGTACGACATTGGCCTTAGTCATGTCAGTCGCCGTGC
ACTCGATGAACACGTTTTTGGTATTGAGCGAAATCTTCGAGTGTTCGCCGTTGATAACGGGCGGGAGCGACAATACCACGCCATTCTTATCCGTGATCAC
GGGGTACACTGACGAATCATAGATGATGTCCGTGTATGGTTTAATATGCTTAACATCCGGATCGGTGCGGTAGAAATCCAGCAGTTCCCTCGCCTCAAAC
TCCTTGTTTTGAGCCAGCGGCTTAAACTTGATCTCGTTGGGTGGAAGCGCCTGTAGTCCAGCAGCACCAACAGCAACAAAAAGATAAAAGATAAAAGATA
AAAAGACACCATAAGCCTCATCTCCACCTCACACTTCAACACGGTAGCTTGCGCTCACGTACACTGTACGTAAACGGTCCCTCCACCGTGTCTAGGTCGT
GCGTGCCAATCGCCACAAGAGTTCGGCGACGACATATGTTCTGGTGCAGTTTATCTTGCAAGTCAATAAAGCTGTCATAGCGCTTCTGTGTGAACTGCAC
GTCCCGCAGTACTGCCGAGACCACGTATGGTCGCACAAGCTGCGACAAAATCAGCAAACAAAGCGACACAATGATCAAAAACAACCTGTTAAATCTTCGG
TTGCCATAAACAATACAAGAGTTTCACCAACAAACCTTGGTGGATGACTTGACCAAGAGTTCGTGCGCCCCCTCCGCCCTCGGCGCCAGCGTGAACACGG
GTGGGCGCTCCTTCTCCAAGAAGACACGCAGTGCACGAGCAATACCCTCCACACACAGCAGGTCATAGCGGTTGGCCGGCACGTCAATCTTGTACAGCAC
CGCGTCCGAGTGAGCTGAATGGTCCTTGTCTTGGCCCTGCTGCTCGCGCTGCTTGAGCTGCTTCTCGCTTGTAATGTCGTCCAACTCGATGCCGAACTCA
AAGCAGAGGACATCAAACTCCTCGTCCGTGTACGTCTGGCCCATGGCCGCGAACAGCTCGTCGCGCTTCACCCCCACGGTCGGCATCCTTTTCTTGGCCT
CTGCTTATCACCAGTGAGTGGATAGAAAGCTGTTCGCAGAGCTGATTCGCTGAAAACAAAAGAGCAGACACACCTCATTTGCTGAATAGGGATGTTCTGG
CTACGAAAAATACGATCGAAAATGGATCGCGAACAGATATTCGAAACAAACGTTTGATTGAAGAAAACGATTAACTTGATGCACATGATAAACAGTCCTC
CCTCTGACAAAGGGGGATCCTAAAACAACAAGCAACTCGCCTAAAAAAACATGTGGATAGCCTACAAGCGTGAGAACGCCAATCAAAACATGGAATACGT
AGTAGTCTGCTTAGATAAAAATAACTAGATGATTAGAAAAGCTATAGAAACTGATCTAGCATAGAGATTTGAACCAGTAGCCGGGCGAAGTATACTAGTA
CGAACGTGAAGAGTCGCAGCCCGACAAGAATACAGTCTTCCCTCCGATAAGTTATGGGTACGGTGGACGACAATCACCATAACTTAGCAGAGGTTATAAC
TTATTGATTTTTGTGTATCGTACATAAGGAGAATCGATCAATTGAGTGATCAAAAAAGCGGACCTGGGCACCCAAACCAACCCCCAACTTCCCTTAAGTA
CAAGCCAAACTCCAACCCTAAGGCTTTCACTGCTGGAACCGAACAAAAGTCTCAGGCTCCTGGCTAGTTTGCTACCTTCCCAACGGTATGAGACGCACCC
ATAGCTTCTTTCGTCTGAGCTAACAATTATTACACAGGGAAAGCCACATATATACATTTTTTAACCGTGTCTTGCCTGTTGGTGTGATATCTGAGCAGTA
TAAAATGTCGCAGATCCGTCTTACCAATGGAAAACGTCTGCAAATATGCAAACACAAGGATGAGAACCCAGATTTATCTCAAACGGCACTGGCGAAATGG
GCTACGGTGGAGTTCGGCCTTGTCAAAACGCTGTCACAGGCATCAATCAGCAAGATCTTTCGAAAGCGGTCTAATCTGGAGAATATGGATCCAAGCAGCC
TAAATGCAAAGCGACAGCGACTGGTTCAACATCTCATACTGGAAGAAGCTGTGCCTCTTTGGGTCCTGCAAATGTCAACACCGCGGAGTGATTATCACCG
GGGATATCATCTGTGCGAAGGCTCATCGGCTTACTCAATTGCTTGGTACTCCTGAAGACGCCATCATTTTCTCGCACGGATGGCTTCATAAATTCCAGCA
ACGTCACATGCTCCGCGCTATCAACATTTACGGTGAAAGCGGCTCGGTGGACGTGGAGGCTATGAATAAAGCTCTGTCTGATGTAAAGAAGGTCATCGCA
GAGTACGCGCTGTGTGATGTTTACAACATGGATGAAACCGGTAAATTTTGTTGTTATATTTCTAATTTGAAACCGAGTCTGACAAAATTAATTTGCAGGA
CTATACAACAGCATGACACCTGACAGGACTATTGCACAGCAAGAA