Description :
From Genome Similarity Track
Location :
Scaffold_145:45800- 47847
Transcript NameFunction/comments
Phymu_g5451hypothetical protein PHYSODRAFT_495533
Phymu_g5452lysosomal Pro-X carboxypeptidase, putative

Sequence
2047 bases(100 bases per row)
AAATACACCGAGTACGTGTCCACGCGCTGGTATCGAgcgccggagctgctcgtgggcGACGTATCGTACGGTAAAGCGGTCGACGTGTGGTCTATCGGCT
GTATGTTGGCGGAGATCGCCACGGGGTTACCGCTGTTCCCGGGAGACTCGGACATCGACCAGTTGTACCATATTATCCGTTGTCTAGGGCACATCACGTC
CAggcagcaggagcttttCCGCAAGAACGCGCTGTATGTGGGCGTGAAGCTGCCGCAAGCTAACGACCTCGAGCCGCTCGAAGCGCGCTTTCCTACGATG
GATAAAGCGTCGTTGGATTTTATCCGACAGACCATCATCGACGAACCTTTGGACCGCTGGACGTGCGCGGAACTACTGAAACATCCTTTCTTCGAGAGCT
CGCACGATGTCTTTGAGGCGGAGCTACAGGAGGCGATTGCTCGCGACCTTAACGACTCGGCTGCGGTCCGGAAAAAGCGGTCGAGGAAGTCCACCAGGGG
GAATCCACTGGCCGGTTCGGTGGTGGTGCCTGCCCCAGTGTCTTCCTACGACGTTTTGTCGAATGGCACGAGCGTCGACCCGTCCAAACTTATGGGGAAG
CATTTGTTCGCGCCTGTGGCtatcaagaaggacaaagGTGCAGTCGCAGCCAGTGAAAGCGCCAGCAACCCGCACATTGTACCACGGAAAACTCCGCCAG
GGGCCATGGGCGTCTCTGGAACGTACCATTTGCCAACGTTACACGGAGCCATGAACAATTCTTCCAGTACAAGCTCGACcacaagcagctccactATCAC
TGCCAGTGTCAACGGTAACGTCAACTCGGGTGGATCGGGAGATACCGGCAGTACCAGTCCGCTCTTCTCGCaaaacaagaagctcatggctGTTCCTCCT
ATTTCCGAGCACCTTGCGGCGACAGCGTACGGACAGCCGATCTCAACCGAGCACATGACGTACGTGGGCTTGCACGATAGTATCCGCGTGTCCTTGACGT
CGCACGGCAGTCGGTTGGGGGGAAACGCAGTAGGAGGCACTGTGCATCcgtacacgacgccgtcgcccaAACCTCCGTCTTCGTACATGAAGAACCCGTA
CGGGACGCAGCAGACGTCCTCCAAGCGTGGCAATGGCAAGAATACGGGCTTTGTCTCGTCGAATCTGCCGGAGAATTACACTGCCAAGAGGACGACAGGG
ACCAAAACGTACAGCAACGGCACAGGGTGGGGTGGCTCCAAGAAAGGAGCAAGTACGAATGCAGCAAGCAACGTACCACGAGGAACGCCCCCACAGACGC
TGTACGCACCTCCGAAGACTTCTCATAGCACAATACGGGCCGCAACATTGCCCCAAGGGAACTTTGCACACGTTCGACGCGAGAACGACTCGCGGAATTA
CTAAGTCGACGCCTAAACGTAATGCCAAGCCACAGTTTTGACACGGATCTACAGCTCCGTCTGCGCTAGTTCCTTCTTGTAGGCGTAGAACTCGCCAACC
CACTGGCGAATGTACTGGAGTTCGATCCTACGGGCTTCAGTGACAGCCGGAGGGTCCAACGGATGGGTGAAGAACAGGTCGAGGTGGTGAGCTCCTCCAG
GTACAGGCACAGCCACAACCGAGGGCGAAAGGGACTTGAGGACGCCCAGACCCGACCACGGATCGAAGTTgccgttgctgaagacgatgttgCTCGCAGC
CCTGAGCGCTTTCATGCCGCCAAACTCGGTTGTCGCCCAGCGAGGCTTCAAGTGGACGCCCCACTGCTCCAAGCACGCGGCGTCGTCCGCCGATTCGTTG
ACTGCAAGGGGAGGATAGACGTCGTGCAGTCCGTCCGAGCTCATGGGCATGTACAGCTCCGAGCACTCGAGGTAGCTCCAGAAGTTGCCCTTGTGGTCGA
TTCTCGCCTGTTTCGCGGCGTCAGAAGTGTCCGATTCATTGAGTTTTGCCACTGGAGACGCCGGGATGAAGCACGTTTCGGTCCCAGTGGCGTTGTAGTA
CACGGCGACACTCTCGCGCAAGGCGGAGATCAGTCCGACGTTGTCCT