Description :
From Genome Similarity Track
Location :
Scaffold_1404:4580- 7848
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1404-fgenesh-gene-0.2Adherance factor

Sequence
3268 bases(100 bases per row)
GATGCTGGGCGTCTCCTCCAGCACGCGGTCGTACTGGAACTCTTCGTGGGACAGCGAACGGAACTTGGAACGCACGCCGTCGCGCTGGAGCGACTTGAGG
ATCTTGGAGATGGACTGCAGCTTGCGGTGGCGTTCCCACTGCGACGGGCACTCACTGTGGAGCGACGACAGGCAGCCCCGCACCTGCGACACTGCGCTGT
CCACGGCGCGCGGCGCATCTGAGCGACGCGAGGCCACGGACGGGGCGGACGCCGTATGCAGCTGAGAGCCGGATCGCGTGCTCGTGCTGCCGGGACGCCG
AGGGTAGTTGTAGTTGGGGGCGTACGGATCGGGGCGATCGTACCGCGACGCAAGGTTGGAATGATACTGCGGCGGATCACGCGCGAACGACGATGACTGG
CGCCGCGGGCCGTCGCTCCAGCTTGGACGATCGTAGTACGAATCGCCCTCGCGGAATGGCATCGAGGTGCTGCGTGGCTTCACAAGGCCTTCCATGAGAT
CACGGAGCTCCTCGCTTTCGTCACGGCCTCCTCGAGCGGCCATGCTCGGACGTCGCGGTGGCGGTGGTGATGGCGCCGCTGCGAGCGNNNNNNNNNNNNN
NNNNNNNNNNNNNATCCGCGACGCGACGGCGGGCGCGCGGACGAGGACGGCGGTGGAACGACGTGCTGGCCGAAGAACGTTTGTTCACCGTCGTCCATAT
CGCCAAAGAACGGCGACTGACCTGGATGCCCCGACGAAGGACGCCGACGCGGCACTCGTTCCTCTGGCTCCTCCTCCTCCTCCTCCTCTTCTGCCTCTAG
TTCGCGAGCGTAGACGTCATTGTCATCCGATGACGTCTCTTCCTCGTCAGCGGGGTTCTCGTCACCAAGGTGATCACGGTAGTGGGCCGAGCCAAAGCTA
TCGTGGCGGCGCTGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGGAACCTCGGCTTTGGTCGAGATAGGAAGCCGATGACGA
AGCCGTCTTGTCGAGCCCGTACCCAGTGCTCGGTTTGTCCGGCGAGCCGAGCGACGAGCCCGAGCGGGAGCGACCAGTGAGCAGCCGTCCCTTGGAGTCG
ACGTACAACATCTCCGTGCTTGGCGGCGGCGGTGGTGGCGGTCGTGACGGACGCTTGAGCGGCATGCCCGGCGACGAGGACCGCGTCGTGGCTTGTGANN
NNNNNNNNCGCTGCTGGACGACTTCCGCAGGGGAGGGACTGCAGTCTTGGCGATCTCCGTCGGGTTCATCACACTGAACAGCTCACTGACCATATCGGCA
GTCGAGTGGGCTCGGTTNNNNNNNNNNNNNNNNNNCACTTGCGCGGGACGAACCTGGCATCGACGTTCGCGGCGTAAACTCGCTGCCGCGTCGCTTGTAC
TCGCCATGGCCGGGCGGATTGGCTCGTTGCTGCCGACGCTCTAAGGAGCCGATGTCCATACTTCGTCGAGATGCGAGGTTGGCTCGCGCCAGTCCCTCCG
ACTGCGGACGCGTTCTGCCTCGAGCGGTAGGAGGCGCGGGCGACCGCGAGAAATCGGACGGGCGGCGGATCGGCCGCGGTTGAACACGCATCACCAAGCT
GTCTTCAGGGGTGAGCATGGGGTCCTCGTGGAGCGTGCCGAGATTGCCATACTCGGGATCCGGTTCGTCAGCTTCAAAGTACGAGAGCTTGCGCTGCGCA
CGGAGGAGATCCCGCTGCAAATCTTCGATCTTCTTTTCCAGGAGATGCACACGTGACCCACGCAGTGGGTGGTTTGATTGCTGCGAACGGAGCGACGAGG
GATTTGAGTACCCATCGTCGTAGGACGGCTTCGCCTGTTGCTGGCTCAAGTTCCCCATCACACGGTCGTATCTGGCAGTCGAGTACTGGTCGTCTTCGCG
ATCGCTCGAGCTGTAGCCGCTCGCCTCGGACGGTGAGGGCAAAATGTCGTCAATCGCTTCCTCCTCAAGATCGGAATACCCCTCCTGATCGGACGCACAC
GATGACAGCACCGCCTTTCCGACAGCGCGCGTGGCCGCAGCCGCGGCGAAAGTTTTTTCCACGACCGCGTTAAAATCGTCCTTGACATCCTCCTCGGAGA
AGCGGTACTCGAGCGTGTCGGGGTCGTTGGGATGCGGATTGGTAGTTGGCGGTGGTTTGGACTTCCCTGCGAGGGAGCTGCGGCGCCCACCAGAAGACGG
TCGTCGCGCTCCGCCGCCTTCGCCACGGCCATTGGCAGACAACTCGACCGTATCACGTAGGCGTGTCATCTGATCGTAAAGCTCCGTGTAGGCGTCTTCT
TCACCAAAGCTCAGGCGCGATTCACCGGCCTCGGAAATCGTAATGTTGATGGTATCTCTCGCGTCACGGATCTGGTCAACGAGGTGTGACAGTGTCTGGA
CAGTCTCACGAGGGTTCTTCATAAAAGTCGAAAGCCGTCGCTTGCTCTTGCTCTTGGGCGTTCCCTTCTGGCTACTGTCAGCCTGCAACAGCCTGGCCGC
GGCGTCGCTGGGTCGTCGCATGAGGTCCTTGTTTTCGTGCTCAATAAATTGGCGCTCGTCGTTCCGTCTCGGTTGGTGGCCTCGTGAATGATCCTGAAAG
TCTTGTGACGAGCCGTCCGACGTCAGCGTGTCGTTGTTGATCTGGTTGTTATGGCGGTCCTGGGACGCCTCCACGGGCACGATCGTGCGGCCAGCCTTGG
TCATACACGCCGTGCAGATGCGGAGCTCTTTAATGTCGTAAATGGGCTCATCCAGCGCGCGCAGCGGCGCACATGACGAACAGACGACTTCGCCGCACGC
GCGGCAGTGGTGCTTGCGGTGGAAGAAGAAGCCTTTCAGACACACGGCGCAGGCCTTGCGGTCGCCATTGGCGACCCATTCCCACTGCTCGAGGAACTTC
ATGCTGCTCACGCGCTGGCGGTCGAGCAGTCCGCGCAGCTTGACGACGGAGCCGACCATGTCCTGCATGATCCCTTCGAGCACGTTGCGCACGAGCGGCT
CAATGTCGCCGTCGATCTGGCAGATGGACGTGATCCGCACGACGTTGGGCTGGTGGGTCTTGGACACGATGATGCCGGACCGCGACAAGTACCCTCGCAC
AAAGCCAAAGTTCTCGAGGAGCGGGATCTCGCGCTCGCGCTGGATCGACTCTTGCAGGCAGAAGCCGACGACCATGGACCCGGGCGCCGGCTTGCGCTTG
CCAGCGTACTCGAGGTACGAAAAGTCGAGCTTGTTGGTGGCGCTACCGTTGCCGCCCTTGCCCTGGAA