Description :
From Genome Similarity Track
Location :
Scaffold_188:458- 1491
Transcript NameFunction/comments
Physo_144447hypothetical protein

Sequence
1033 bases(100 bases per row)
TACGGAAAGCCGCTTCATCCTCACTGTCGGAGCTTTCGCGTCTTGGCATCGCGACCTTAACAACGATTTCAGGAAGCTGCCAGACGTACTCGTCGGGGCT
GTACTGGTTGTAGTACTTGATGCAGGACTTCAGCGCCTCCCACCACGGAGAGAGAAATCCCCAGCGCTGCTCCACCTGCGCAGCAAAAGAACCTTCTTCC
TCGGCCATCTTGCGGCTTCGCTTTTCGAAAGTGAGGCAAATCTTTCAATTCGCAGCATTTTTGAGGCAATTCTTGTAATATTTTACTGTAATTTTCCGCC
TGTAAATTACCAGTAACTGTCTTTTTGAAGTTCTCTGAAAGTTTACCCATACTTATGTTATTTTCTTTATCCGATACACGCTCTTGATTGGTGTTCGTAA
CAGACAGAAGCCATGGCCGACGGCCATGCGGACGCGCCGACCGCGACGTCCACGAGCTGGCGCTACTGTCTCCACATTACCTACTACGGTACGGGCTTCG
TGGGGTGGCAACGACAGCAGCAGGCAGCGAAAAGCAGCTCGGGCCATGACAGTGTGCAGGAGGTGGTAGAGAAGGCTGTGACGGAGACTTTGGGGGCCTC
GCAGCGAGTCAACGTCACGGGCGTCAGCCGCACGGATGCAGGCACGCACGCACTCTATGTACGTGAGTTTTGAGAGCAAACTGGGAAATGTCGGGGTGTT
TTTACTAAAGGGTGTATGCAAAATGTGCATTCGTAGCAATATGGTTTCATTCGACTCGGCTCGGAGCTGCCGATGTCCTTGGAGGAACTGAAAGATCAAG
TCAATGCCAAGTGAGTAGCAAAAAAGAATGTCCTCGACCTTGTAGTGCTACGTTACAGTGGTAGAGTGACCGCGTGCTGTCTTGCTATGCAGACTGGGAA
GTGACCGAATTGTGGTGCTTGGTGTGACGGTGCCGACGACGGGCCCGGCGCGGATTCGATCGCGGTACAAGAAGTACATTTACTACTTGCAGCAAGGACA
CCGCCCGGACTTGGAGCTGGGCAAGTACTCGTG