Description :
From Genome Similarity Track
Location :
Scaffold_19:457939- 459000
Transcript NameFunction/comments
Aphas_H257_08564myosin-like protein

Sequence
1061 bases(100 bases per row)
TTTGTATGGTCGTCTGCACTGTACGGAATTGCTTGGTCACTTCGAGCGCGCATCATGCAAATGGTGCAAATGCGCACGCGGGTGAGGCCAATGTTGGTCG
CGTCGATCTCCCGATGGGGCGAGCACATGTTGCATACCACTACAAGATAACTGATATATACTAGGCGATTCGAGTAGTCACATAAAGTAGCCAATTTGAG
ACTGTCTAGTTACATGATGTAGCCTATTTGAGACTGACGAATCACATAAAGTAGCCTATTCTACCCATACTAATCACATAACGTAGTCAATTCGAGAGTA
ACTAGTCACATAAAGTAGCCAATTTGAGACAGACTAATCACATACAATAACCAATTCTACGCGTACTAATCACATAACGTAGTCCATTCTACACCTACTA
ACGTAGTCAATTCTAGACATACTAGTCACTTAAAGTAGCCAATTCTAGATAGACTAATAACATAACGTAGTCAATTCTACACGTACTAGTCACATAACGT
AGTCAATTCTAGACATACTAGTCACTTAAAGTAGCCAATTCTAGATAGACTAATAACATAACATAGTCCATTCTACACGTACTAATCACATAACGTAGTC
AATTCGAGACACACTATTCACATAACGAAGTCCATTCGAGATAGGCTCGTAGCCAACTCGTGGACATGCTACTGTATCACATGTCGTGGCCAAGGATTCT
CGTACCTTCGCCGCATTGGCGGCAATGATGTTTGCGTCGAAACAGAAACATCTTGAGGCACACGGCACATGTCCGCCGGTCCGTGTCTGGAATCCACCGC
CAGCGCTCGACAAACTGCATCTTGCCCAACCGACCTCGCTCCAGGTACATGGCGAAGTCGCGCACCGCCGCCACGCGCCGAAACATCATGAGCTCGAGGT
CCCGCGGGTGCGCGGGTTGCAGCCGGGCGTTTTGGATCTGGCAGAACGACGTGAGCCGGACCGTGTGTTCGCGGCCGGTGGCCGTCACGAGCAGCCCCGT
GCGCTGGAATGTGTCGCGCTGGAGGCCGTAGTGTGCAAAGTCGGGCACTTCACTGTCCATG