Description :
From Genome Similarity Track
Location :
Scaffold_475:4578- 11138
Sequence
6560 bases(100 bases per row)
TTGGCTCGTGCCAGATTCCAACCTGGCGAGCGTCCTGGTTTAACATCTCCTCGACCTTCGGAGAAAACATCCCAGCATGTTTGGTAGGCACGTACCACTT
GCAGATCAAGTTATAGAACTCTTCCATAGGGCACTTCTCATTCTCATGCATCTCTCCACAAGCTGCAAACACATAAAAACATTTGTCCGATGGATGTTGC
TTGCCGCATTTCTGGCACGTCAGTCTCTGCCAGAATCCACTATCGTCGTGTCTCTTCAATACACAATGAGTGTAGGCTTTCTTAAACGCAACGCGACCCG
GAATATAGCCTTGACAATTCTCGTCGGTTGTAGCCCGTTGATCTCCGAACTTCGTCGGCGGTCCGAGGTCGTAGCCACAAACCTATTACGTGGTTCAAGT
TCCGCGTCCGATCCGCTAAAGTCGGATTCCAAAGAACTGTCCGCATCCTCCACGTGAATGGGCCTCATGGCACGCGCTGGTTTAGCCGGTTTTGGAGAAG
CTGTGGGTGCAGATTGTGTTTGACTTTATTCGATCCCATGAGTGATCGAGTTTGTCGATATTCCATGTGCTAGTGAGAGCGTAAGGTACCCTCCATATGA
TCCACATCACCGATTCGTAACAGCGTCAGTTGCTTGTTCTGATCGCGATCATACATGGTCCCAATAAAGTGTTCCACGTGTTCACGACGAATGTCTGGGA
ATCCATCTCGAATTCTCATCTTTGCTCGATTCGCTGCCACATTTAACCGATACAGGTAATCCAGCGGCAGCTCCTCCGGTCGCTTCTTGGCAAGATAATA
TTGTCTCCCAGCGGACATACCATAACCACCATATTGCACGAGAAAGTTTTCCACCAGGTCCTTCCACAAATGACAAGTGGATCGGCTCATCTGACTGTGC
CAATTTCTCGCCGGACCCGTAAGCAGATCTCCAAATACTAAGCACTTCTACACATCTGGGGCTTGATCATGTAGAAATGAAAACGCAGACTTAACCTTGC
CGATCCAGCTCCTGGATCTATCCTCTTCTTTGTCCTTCCCATTGAACTCTTCCAGTTTTGCGATTGCAGACATCCAAATCCGCGGAGCGCTAAGTCCACC
ATCTAGCACTTTCTCCGCAGTAGCTACAAGTGGTCGTCTCGACTCGACTTGCCCTCAGTTGTTGGGATCTCCTGCTCCACGATATTGCATTTTAGCGCCA
CCGTGATGCGATCCAACCGATTCCATCTCATAACATCAGGGGTGTAAAACTCGATATCCGTTGCAACCTTGATCATCTGGCTTGGGTAGATTGATTCGCG
GGCCTTATTACAGCGTTCCTGCTGAAATCGTTCTATGGCAGCATCCAAATATGATTGTAGTTGTCCTTGGGTGGTCGAATCCGCATCTTCTTTAGCGCGT
ACGGGTGTTGATCGCGGTCCGCTCTCGATCCCTTCCCCACGACCAAGTAGATCAGCCTTCGTTTCCATGTATTCGCGCAGATTAGCAGCTCCACTTGGGC
CTAAAGACATCCGCTGAATGCCGATTGAGTCTTCTAACTCTACTTCAGATTCGGCTGAGGCATACTGGGAAGATTAATTGTGATATCCTCTCTGAACTTC
TGCAGCCGTCGGTTCCACGTGATCGTTCGCCGCAGTCGCTTCCGCGTGATCATCAGATTTACGTATGCCCGTCAAAGGGACTAACTTCTCATACAGCGGA
TGGCACGGGTGTATCAAGCGATCCTGTTCGCAATCCAACAGCTCTCTTGCATCGAATGATCCCGCAACGAATACCGCTTCGTTCGGCAGATGTATAATTA
CATTGATTCCATCCAGTGTATTCGACGCGATCACTGGGGTTGATATAGGGCCTTAAATTGTTCCAATAATCCTAGGCTTCAGTATCTGGAGCACTGGATC
GTCAAGAACTTCTTGAGCGTCCTCCAGTGATACATCTCTGCTATCTGGTCCAGTTGCCAGCCTTCCATCTTCCCTTCATCTTCTACAAACTTGATTGGTC
TGATGGCCCGATCCCGTCACGCGATCGGGGTGATCCGATCCTGGCGCTGTCTTCTTCACTCGTGCAGTCTTCGACTTCGTCTTTGTTGACGTTGCAGGAG
TGACCTTGAGTGGACTTTGTTCGGTTTAACCGAAGGGCTTACACCCAGCGAATCATGCATTGCAGCATGATCCACGGTGGTCCTCGAATGGACCTCAGGA
GGGGGTTGGTGGTTTCTTCCCAATCGATCGATCGATCTTCCTCTTTTTTTTGTCATCAAAGCCCCTCCCAAACGTTGTTGATCTGTAGATCCTTCATCTC
CACACGTCCGCGACGATCTCTCTTTCGCCGGCGCTTCATTCCCAGGTTCAGTCTTGATCCTAAAGTCTTCTCCAAGGGACTCAAGGTGAAATCCCGAGTC
ACCAGAAGATCCGGCCACGCGCACCACTGTGGTGGAGTGGGATTCGTTCATTTTATGAGGCGATCCCAACTCTCCACAGGCGCCCAGACGACCGACTAAC
GGAGGGGGTACTCCTATTCCGCGTGCTTTGCCCTCCTCACCTTGTGTAACCGTCGGTAGGGCGGGTTGCACTCTTTTAGGTGGACTCGAGTCGATGCCGA
ACTTGACCGTGGTTGGGATTGGTGTCGATTGCGTGGAAATCCTCACACGATTGCGTTGGTTTTCTTCGGTGGGTCTCTGTCTGAGTTGATCTGACCTGAT
ACAGATCGCCTTGCCTTACGGTGATGCTTGATTCCGCGAGCCTTCTGACCACTTGAGCCGTCTCGCGATCTTGCACCCCTTGCCCTTGCTGTGTTTGCTG
CGTCCGATCGCAGTTGACTTGGTGTCTTGATAGTTCTTGAACGCACCTGGCTTAACCATCCAGGTGCGACACTTGTGTAGACGTGCAGCGCGGCTCTTTA
TTGTCGGGAGGCCAAAGATCCTGCCCGTAAGAGATAGCGTGTGTCTTTTGAAGTAAAGTGAACTCTGTTTAATGTCAACCAATCAATCCAAAACCTATCA
CTGTGCCTATCTGTATCTCCTAACCGGAAAGCCATGCGTCACATTTCAGGAAGATCGTCCCCTCGAATTTATGTTGTCCACATCAGGTGTATCAACAGCG
GGTCTTCATGTGGTCGATCTCGGATGTCACAACAGTCGGATCTTCATGTGGTCCACCTCGGATGTCACCACCATTCGATCATGGATCACGATCGCAAGTT
GGGGATCGCGATCCCAGATCTAGATCGTGACCGCCAGTTAGGGATGGTGATCCCGGGTCTAGATCGTGACTGAAATTTAAGGATGGTGATCCCAGGTCGT
GGATCGCGATCGCAAGGTGGGGATCCCGATCGTAAGTTGGGGATCGTAATCGCAAGTTGGGGATCGTGATCCCTGCCATGTGTTGCGACGGATTGTGTAA
TAACACTAGGTCAACTGACATCTGGCCTTGTCCCACGTAGTGGCAATCCTGCTCACTGATGGTTGGGTGCGCTATTGCGAGCCACCCGTCCCAGCTCGTG
TCCACCAATCAGAGCCCTTTCAGCTTAACTGAAACATACCATCCGTGCAGTCCCAACTCCAACTCAACCAAAACCTTCCTTGCGACCACTTTGCCACATT
ACCGCGTCTATATTCATAAGGACAACTTTGTAATTGTGACGCAACACGTAAAGCATTTTCAGACGTTTCCTGACGCGGACAACGAGCAGCTTAAACTCAG
TTTCAAGCCAGAGGATCAGGGTAAAGCAATTCAAGGTGGAGAAGTAAATCGCTCATAATTATTGCGATGACGATGACAACGAGAAGGGCTGCAAGAAAAA
ATTCAACCGGTGGACGCGTGCCCCGCATGAAGCAACCAATCAGGCAACCCAAGATGCAATACATATGAAAATTGACGTAGGCACCGTGCTTCAAGTCTAC
GAGGCGGACCCGAAGACGCACGCTGAGGCGATGTGCAATCCGAAGGCTGAAGGTTAGAGAAAGGCGACGCTCGAAGAAATACGGGCTCTTGATAATGACG
ACGTGTGGAACGTGATCAAGCGTCCAGGCGGTGAAAATTCGCTACAAAGTAAGTGGGTGTACATGACAAAGACCGAAGCGAGCGGTGCAGTCGAGCGGAT
GAAGGCACGACTCATGGCATGTCGCAATGGGCAAGTCTTCGGTGTCGACTACTCTCTTACCTTCGCCGCTGTGATGGACATGTCGACAATGAAGGTGATC
CTGAGACTTGCAGGGACATGGAGTGTTCCTGCGAAGCAGGGTGACGTCCCAAATACCTTTGTTAGGGCTGACAAGGAAGAGCATATGGATATATTGCTTC
ACGTTCCAAGCAGTATGCAGATCAAGGACTAGAATCTCAAGGGACTGGTGTAGAGAGTGCAAACGACGTCGCATTCGANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTCGATTACAAGATGCGGAAGATAGTTTAATATTTAGGCGAGCAACCACCAA
TGGGGGCCGCCCCTGCCCACCCGCACCTCAGTGTGTGTGATAGTTGGGTGGGCTGGAGGC