Description :
From Genome Similarity Track
Location :
scaffold_888:4578- 11069
Transcript NameFunction/comments
Pl_101975tetratricopeptide repeat protein, putative
Pl_101976hypothetical protein PHYSODRAFT_263017
Pl_101977hypothetical protein PHYSODRAFT_354827

Sequence
6491 bases(100 bases per row)
CACTTTCAAACCGAAGCAATGGCAGACGCGGACGAGTTGATGCAAGAGCTATGCGGCGTGAGCCTGTCGGCTATTGACGACACACAGGATGTTGCGCAGG
AATTGCTGGAGCGTCGACTACTTGCAGTCGAGCGCGCGGTGCTGGAGAGCGACGTGAAGAGCGTCATCGAGGTGCAAAAGGATGGCGGCGAGATGGCTTC
AGTTCTGGCAATGGCGAAACTCATCTGCGAAGGCGAGTACGCAGAGGTAATTCGCCTGCCTCAAGCACAGAAATTGCTGCAGACTGTGACTCAATTGCGG
AGTGAAGAGCATACCAACGAGGACACACACATTTGTGGCAGCATTGCATCGGCTTTGCAGAGCTATTTACTGGACCAATGCGACAACGCAGAGAGCCGTC
TCGTGACCGCCTACGAGATCCTGTTTGTCGGTGTTGCCTTCTTCGACATGTACGTGCAAGCTAACTACACGGGTCCAGCGTTCGAGAAAGAGACACTCCG
TGATGTGCTGGATCTTGTCGCGCGGCTAGTGACTTGCTCGACTGATAGCAACGACAAGAACACGCACAGTGATGCGCTCGTGGCGCTGCAAGTGGATGGC
GAGAGCCCGTTCTACATCTGTGAGTACCCACAGTTCCTGCTTTTGGGTCGCTGCTTGTTGGACTTTGTGGGCAACCATGCGTACAACGACTGGTCCGTGG
CTGCCGATGAGGCTGTGAGCGGCCAGAATGACAATGAAGTATCGGACGATGTTGTAGAAGGCCCTGCCAAGCGTCAAATTACTGGTGGAGCTGCTATCCG
TGCTCTTGGTGAGATGTTGGACAACATTAAATCAGCTACGTGGTGGAATGCGCGTGCTGCTGTGGCTCATGAACGACTTTTGCTTGCAAAGCAGCCATCG
AACACGTTGTGGTTTGAAGCTCGCCGTGGATACATCCAGACGCTGAATACAGCTGAGCTTTTTGCCTTCGAGAAGGATACTCAATACCTGCTTGCTCGTG
CATATGTGGAGTGGGGTCTAGCTCAGCACCACTTCGACAAGAATAAGCACGGCAAGTCTACCTTTGCGCGTGCAAAGGACATCTCTGGTGTAAGCGTGCA
ACTCAGTGGATCTATGGGCAAGCGTACAAAGTTCCAGCAGAAGAGTGTTGCTCAAATGGTGTTGCTTGCAGCATCAAAGAAAGAGCCTACAAATGCAGAC
GAAGATGCTTCCGTCTATGCCACCGCTGTGGCCGAATCGACTCATGTGGACTTTGGCGGTAAGCAGATGACAACTGATGGTGAAGGCGAGAGCAGTGCCG
CTGCTCCGCCTGCTGACGGTCTCACAGCCGAGGAAGAGCACATCCAAAAACTTGTGCAAGAAGGCGAGGCTTCCTACCGCAACGTGAACTTGGATCAAGT
GGACCAGGATAACTACCTTCTGGAAAGCATTGCATTCGAGGACCGCAAACTCACGGAGCAGGGCAACCTGCAGATCGTAGACCAGATTGTGCTTCTGGGA
CTCTGTCTAGATGTGAAGAACAGCAACGCCAACGATGGCCTCACCCGTGAGGAGATGATGCCTTACGTGACGCGTGTTCTTGAAAACCCCAACAATTGGA
TGGTATACTCTACGGCACTACTGGAACGCGCATGGCTCGAGTGCGAGAGTTCAAAGCGCCGTGAGCGCGCCGTATTGCAGATGCAGGCCCTTGTGGATCA
GCATACCACGCGGCTCACAATCACACAGAATACGCTGGAATCTATTGCGGATTCAGCACCAGCTCGTGAGCGTATGCAGTTTGTGTATTCGCTGGCCTTC
CCTCCGCGGTATGCCCTCAAGCGCGACCTGGCTGAGCGTTACTTCAAACTTGGTGTTCTAGGTAGTGCTGTTGAAATCTGCGAAGAGCTGGAAATGTGGG
ATGACGTCGTTAAGTGCTACCAGATTTTGGACAAGCCAATGCGCGCAGAGAAACTTGTGCGCGAACGCTTGGATATTGCCCCCACACCCTTCATGTGGGT
CACGCTCGGAGACCTCACCCAGGATCCATCACACTACGAGACGTCCTGGACTCTCTCAAAGCAGCGGTTTGCTCGTGCCAAGCGTTCACTCGGACGCTAC
TACTTCGAGAAGGGCGACCACGAGGCAGCAATTCCCCATTATGAGGATGCCGTGCGTGTGGGTCCTATGCACACGGGCGCTTGGTTCACTTTGGGTGCGA
TCGCGATGCGCATACACCAATGGGCCCTCGCGATGCGTGCATTCACGCGCGTCGTTCAGCTTGAACCGGACAACGGTGAGGCCTGGGGCAACTTGGGTTC
CATTCACTTGCACAACCAGCGTTACGCAGAGGCTTTCGCGGTACTGGAAGAGGCACTCAAGCAAAAGCGCCACATGTGGCAGATGTGGGAAAACTATGCG
CTGTGTGCTATGGAAACAGAGCGCTACGGCGAAGCCATGTACGCCATGCATCAGCTCCTTGACATGCGCGCTAAGCACAAACGCCCTGTTGATAGTGAGA
TGCTCGCGTGGCTCGTGGAGGCTATTGTGTATCCCGACTCGCTAAAGAAGATGCAGCAGGAGGCTGATGCTGAAGCTGGTGTCACTCAAAAGGTGGTCTC
CGACGATGAGGACGAAGTCGACCGTGTCATTGACGACGATGATGAAGACTTGGCAGAGCTCGATGAAGCAGCAGCAGCCACTGACGCAACTCCCCCGCGG
TCCGACTCGCACTACAAGAAGCAACTGGCGATGCTCTTCGGCCGTGTGACGTCCATCGTGACAAATGACGCCAAAGTGTGGCAGGTGTACGCGCATTTTA
ACGACGGTGTGGAAGGTCGTGCCGACAAGGCTCGTGATTGCCGTCTGAAGCAGTGTCGCGCATTGCAAGTTGCAGGTTGGGAGCGTGAGCAGCAAAAGGT
AGACAATCTCTGTATGGCTGCCTCTCGGCTGACCGAGAACTACCTGGCCGAGGGCACCAAGAAGGCGCTGTACTCGTGCCGGCTGTACATCCGCGGCGTT
CTCAAGAAGGCTCAAGTGGATTTCGCAGATCTTGAGTCTGTCAAGACGCTCAGTGCTGCATTGGATGAGGTGAACGCACGGGAAGCACAGCTCTAGACAA
ATAGGTAGATGCTCAACATGACCATACTAGCGGATACCTTGACTGGAATGTAGCCATTTGCCAGATACTTGGCCATTTTATCCAACGACATCTCATCACC
ATCTCTATTTCTACCCAATGAGATCGCTTTATAGGTTTGAATCGCATTACATACAAATGTCAAGTCCTACATTGCGCGGGCGATTTTGGCGCCTGTGAGG
CAGTCGCCAATCAACCGCCAGCAGTGTAGATATGTCTCCGAAGCAGGTTGGGCGGCGGGGCTCAGCGGTCAAGAAGCGCAAACTCGAGACTGTCGGGTCT
AGTGACGCGCCCAAGAAGGTCAAGCGTGGACCTGGTCGACCACCGAAGAAGAAAAAGCCCGTGGTGGTCAAGGAACCTGCGACTGAGCCCGAGGTTGAGC
TGCAACTCACGGTGGACCCGGAGACAACGAGTTTCCTGCGGCTCCTGGAGGATGACACACGCCACCTGCCACCCCCGCCGCCCCCACTCCCAAAACGCCG
TGGAACGGCCAAGTCCCCACCTGAAAAGCGTGTCGTGACGTTCCAACTACCCTTTAAAGAGGCAGACATCAAGCTTATCGAGGAACGCCAATGGGTGCGT
CGTCCACCACCGTTCGGCAAGATCAGTCGCTGTGTCTATGTATCTACTAAGATGCCCATTGCCGATTTCCCAGTGCATAAGTGCACGTGTTGTGAAGAGA
CTCACAAATCCATGACCAAACGCACGACTATGATGGCCAGTGCAAAGGCTCAAAAGGAACTGGAGGCCAAAGGGACACGTCATGACTCGGAGGAACAGGA
GATGATGTACTGTGGAGAAGGATGCTACAACCGCATGCTGCTCATTAGTTGCTCAGATGAGACGTGCTCTGCTCCCGACTCGAGTATGTGTAGCAACCGT
GCGATTAAGAGGAGGGAACTCAAGCCGGTGCGAGTGGAGTATATCCCTGGCCCCGGATTTGGACTCATTGCCAACGAGAAGATTAATGCGGGAGAGTTCA
TCATTGAATACGTCGGTGAAGTGATTGACGACGTCGAGTGCGAACGCAGAATGATCAAGTACAGAGACCATGGCGAGGTGAGCAGGAACTGATGTATTGC
GGAGCTGATACTACTGTGTGCTGATGTTGTCGTTGGATTGGTTTGTTAGGTCAATTTTTACATGATGGAACTAGAGAAGAATATCGTGATCGACGCCAAA
TACCGCAGTAATGAGTCGCGCTTCATCAACCATAGTTGCGACCCCAACAGCGTTACACAAAAATGGTAAGTTCTTCACTCTCAAATGGTTTGTCGAAGGA
GGTATGAAAACTGACCAACTGTGATTTAACAGGAATGTCGACGGCATGCAGCGTATTGGTATCTTTGCGCGTCGCAATATTGCTCCCGATGAGGAGATCA
CCATCGACTACAACTTCTCGCATTTCGGCGAGGCTACCCAGTGTAAATGTGGATCCACTGCGTGCACAGGCAAGATTGGTCTCAAGCGATCAAAACTGCC
TCTGTTTAACCCTCGTGTGGTGGGCACCGCAAAGGCTAAAAAGCAGGTGCCAGTGGACGAGGAACCACCTGAGCTTAAGCGTCCCGTTCATTTGACCTCA
CTGGCGCTGCTCAAAACTTCTCAGATGGATGATAGTTGGTTGGAGTACTACGGATTCAAGAATCGTCGGTTGTTCCTCAGCCACCGAACTCGGCGACCCA
AAAAGGTGGATAATGGCGAAATAGTAAACAACACCGACGTTCGTCGTAGCCCGCCTTTAAGCAGTCCAGCCTCGGAGTGCTCAAATACGACCGAGGAAGA
TGTGTCGCTCACACCACCACAATCGACTCAGAGTGACCCCATCGAAAGGAAATTACAAAGAAGCAACTGGTACAAGAAGGTGATAGCTGGAGAGCATTTG
CCTGAAATGAGAACACTGCACAGCTACATCTGCGGAGGCAAGTCAGACTGGACGACAGACCTCACAGCAAGTACCATTATAGCGGCTGCTTCCCCTTCAC
CAGTAAAGAAGAGGGGACCGGGCCGCCCGCCCAAGAAGCGTGGTCGCCCTAAAAAGGTGGCGCCTGTGCTCACCCAACCAAAGCGTGCTCCGGTGGGAGC
AAAGCTCATTCATAGACGCCTTGGTCTCTCTCAAGCACGATCACGATGCGTAGATGAGCTGTCAGCGTTTGCAAAACGCAAGTCGAAGTGGAATAAGCGT
ATTCCCTCGTCCAGAACGATCGATCCAGACCGCATTCGTCGCCTCATTGATCGCGTAAAGGGCAAACAGATCTTCATCAACACCGACCAGGTACACTGCA
GCTGACAACTCTTCACTTGACCACAAGCTGACTAACGTGCTGCATATTTTGCGTCTTCATGTCCACAGAACGATCTCAACGAAGACGCCTGCTTCCGTTG
CGGTCTAGCTGGTGAGCTCATTTGCTGTGATGGCTGCCCCGCTGCCTTCCACCTCAATTGCACAAACCTCGCCATGGTGCCACCGGATGGAATCCCATGG
TTTTGCTCGGAATGTACAAACCCGAAGCATCTTCAGAAGACTTCAGAGACGTCTGACACGTCTATCATTGCTGCAAGGGGCACAAGGAACAGTGGTCGCG
CCACACAAACGGACTACACTGGCCGTCATCTACGCACTCACACAGCACACCAGGTCCCAAGCCTCAAGAAGATTTTTCACGTTCCGGCGACTCACACTAA
GCGTCGCTACAAGAAGCGCCATAAAGCCACGGACCGTTCCTACCGTGAGTTGGAGCATATGCCACTCCCCGTGTGGAACGAGAGCGACGAGGGCGAAGCG
GAGCAGTAGCAATACTGCATCAATCCTCTCCTGTCAAGGCGATTCATTTGTCCATTCGGGTGATCGCGAACATTTCAGAGCTGGTGATACTTGCACAAGA
CTCGACATTGTAGCATTGTCTTTGACAATGTGGCCTACTAGCCAAGACCTTCGCTTAGAAACTGATGAAATAAGACAATTGGTTGTTGAAATGGAAGTAA
AATTCTTAAGCGCAATGCATCTCTTTATTGGTTGTAGAGCTTAGCTGGCACTGGGCCTTCCACGCGGTCTTTAAGGAACGCCTCACTGTCTTCCTTAGCT
CGCTGTAATGCAACCATCATAATAACAATTAGAGACACCCATCGAGTATTGCAGTGTGCTAATTAGATGCGCACCTTGATGGAGGTGACGAGAGCCGCGT
AGGGGCCTGTTGACTTGAGTTCTGGCATGGCTTTGCCGCCGTCCATCTTGCCCGAGTACGAGTGGTTGAGCTGCTCTTCTCCAGGCGGTGGCGCGTACTC
GTTGGACGCATCGGTGTCACTCGGGAAGCTCTCAAACGAGTGCACTACCTCGCCATGGAACTTGTATGTCGCCTTGATGCCACTCATGATT