Description :
From Genome Similarity Track
Location :
Scaffold_1533:4578- 5885
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1533-fgenesh-gene-0.2Sulfite oxidase

Sequence
1307 bases(100 bases per row)
CTGCTGCCAGAAGCTTAGACTCTCGGTCGCTGAGAGCTCGATGTGGTGCAGGAACTTGACGTTGCGGGCGCCGACTGTGCCAGGCACGATCGCGCGCAAC
GGGTATCCGTGGTCGCGGGGCAGCGTCTCACCGTTCATCTCGAACGCCAGCAGCACGTCCTTGCGCGGGTCGAGCGCAGTGGAGACCGGAATCGACGCGC
CGTACGTCTTCCCATCCATAGGGTCGCTGTCGAGCGCTTCAAAGTGCACGTGTCTGATCACAGCCGCACACTGCTCACAGCTCTCATCGCTGCCATCGTC
ACCATCATTCTCGTGAAGCGCACAGACTTCGTTCGCCTCGCTGATGCCCACGTGCCTGAGCACGTCGGCGAGCAGCACGCCCGTCCACGTGGCCGTCGAG
ATCGCAGTCTTCTCCCATACAAGTCCTTTCACGTTCTTCACGCGCGACATCTCGGAGCGCCGGTTGCCCGCGCACTGGATCGTCACGGTGATGGTCTTGT
GCGCGAACGTAGTCTTGAGCTCGTCCAGCGTGAACACGACCTCTACAACAAAATTATACGAATGGTAAGTGGTCTATCAAAGGCATTGCACAAGTACAGT
TTGATACGCAAAGCGTACCTTGCTTGAGCCCCAGACCCGAGAGCGTGAGAGTGAACGAGCTGAGGTCCTGGATGTCTGGCACGGGCAGGTGGTTGCGCAC
GAAGAAGAGCTTGTTCGTCGTCACGAACGACTGGAGCAGCAGCTCGGGCGGCGGCTCGGCATTGAACGGCGCCTTTGCGCGCACGTGCAGTGCCGGGTCG
CGGATCGGGTCCAGCGTATAGCTGTTGCGCTCGATGCTGAGCTCTGGACCTGGCGCCGCTTTGGCCCTCACAGGTTCGCTCGATGGGGCGTGCATGTTGG
TGCTGGATGGTGGTGGCGATTATGAAGTCAGCGCTTGACGAACTGAGGCTCAGACGGCGGAATCGCAGACGTTGAGGAGCGTGAGGTGAGCCCCCGCCAC
GTGGACTTGAAGCGCGCTTCCCACTGGACCAGGCGGTGTCGCATGCACGAGGTCCGCTCTCGTGATTGGGCAGTTGGGAAGGCGAGGTTGAAGCCATGAT
TGAGGATCCGAGATCGACTGGCGCACAGCGGATCAAGAGTGATGGTCGTGTCGAGCAAGAGTGGTGAGTGAGGGTGCATTGCGTCGGCACTCTCGAAGAA
CTTGATGAACTTCGTGCGCAACACCAGGAATTCCTACTATTGGCCTGGAAGCGGCCAGCGAGCTGATAGAAAGTCGCATCGCCTTCCATGGTTGCGGCCG
AGAGCAG