Description :
From Genome Similarity Track
Location :
Scaffold_109:45776- 48075
Transcript NameFunction/comments
Phypl_g3330conserved hypothetical protein
Phypl_g3331hypothetical protein PHYSODRAFT_484729

Sequence
2299 bases(100 bases per row)
CGCCAGTGGATGGAGACGCCcagcgtggtgctggacgagaagcgtctgctgcgcAACATCGAGCGgatgcaggcgctggcgacggcgaacCAGGTGAACC
TCCGCCCCCACGCCAAGACGCACAAGACGCGGGAGATCGCCGCGATGCAGTTGGCAGCTGGAGCTTGTGGCCTCACCGTCTCGAAACCATCCGAAGCGTT
GCGGTTCCTGCGCGGTGAAGTGCCGGGTCTCGAGAGTCTCATGCTGGCGTACCCGGTGGTGCAGAGCAACAAGGTGCAAgaggtggtgaaggcggcgcag
gaggtTGGCGTGGAGTTCCTGCTGACCGTGGACAGCTCCGAAGGAGTGGACGCTGcgcagaaggcggcggaAGCTTGTGGCTGCActttgaagctgctga
tccACGTTGATGTGGGATACCATCGCGTGGgtgtggaggaggaggacccgAAGCTactgcagctggcgcagcggaTTGACAAGACGAGCAGCCTTGAGTT
TCGCGGACTGCTATCCCACGCAGGTCACGGTTATCGCTGCAAGTCCGTTGCTGAATGCTCCGAGgtggcggagacggagaggAAAATTATGGTTCGCATC
AAGGGCACGCTGGAGGCCAATGGAATCACTGTTCCTATCGTCTCCGTGGGGAGCACCCTAACTGAGCCTGCTCGTAAGAGTTTCGTGGGAATTACGGAAA
TCCGTCCCGGGAACTACGTGTTCCTCGATCGCACACCCGTGCGTATGGGACTGTTTTCGGTGCAAGATGTGGCGTTGACTGTTCTTGCGACGGTCGTTAG
CTCGAATAAGTACAACTTCATCGTGGATGCTGGTTCCAAGGTGCTCAGCTCCGATGGCGCGCGATCGGCCGGCGAGTTTGGCTCGGCCTGCTTCGGACTC
GCATTTTACGAGAAGGATTTTGAGCGTGTGGTGAAGGAGCCTACTCAAAACAAGACTCTGCTCGACGATGGCAGCGAACTGGTCTGCTTCGAGATGACCA
GCCTGTCAGAGGAGCACGGGTgggtgaagaagatcgaaGGCGTTCCCTCGCCCGCCATTGGCGAGCGCCTCGTCATCGTGCCTAACCACGCCTGTGTGGT
TTCGAACCTCACCAACAAGTTTTACGTTCAAGGCGAGGAGCCAAAGAGCTGGACTTTGTTGTCTCGTGGATGCACACAGTAAGAGGGGCGTGCTTGTTTG
CGCGGAGGAAGGTCATCTTACGCACAGAACTCAAGACAGATCTCAAAAAGGGAGCTGTCTAGCTCTATTAAAACCATCGCAACTGAAGGTTTTGAACAAA
CTCGCGGTTCGCATTATCTTCCATGCGCTGGATCAACTCCTCTTTCGTCTGCGGCAATTTACTGtccgcgccgccgtcttTGGCTCGGAAATTCCTGAGC
ATTCGGGCTGTAGCTGCCTTAATCACTTGGAGCTCCTGCTTGTGTGTTGTCATATAGTGGTCGAACGCTTCAGTGTGCAGATGCGAGTCGTGTAATGACT
GTGCCCACTGCTGCTCATAAACCAACTTCAAGAGGTGTCTGCGAAAAGGAGATCGCAATACTTTGGTGATCATGGCCCTGAATGCCGCGTcatccacatc
tgacgatTGCGTCGCAGCATCCGCAATGCTCTGATAATACGCAGCACTCTCAGCCTTCGCAGTAGGTGGTGGCGAGTGGTACATCCACGTAGTGAGAGCA
AATCTTGGCCTGATGGCAGGCATCACGCGATGCAGCATTTGCTGCGACGAAAACAGCACCAACTTGCCGAAGCGCGGCTGCACTACGACCCGTGATTTCG
GGAACGGGTAGATCACGATCtcgcctccgtctcctgctTTCCACTCCTCATTTAAGTAAAGCACAGCCGTCACGcacttgccgtcgtcgccgtaggTATC
AAAGTGCATTGGGAAGCAAGCCCCCCGCCCAGCGTTGTGCTGCACCTTGACCATGTGTCCTGTCAGTCCCAACCACTCCGGTAACGCTTGACGTAGGGGG
CCAAAAATCacttgctgctcgaagaaATCCCTCAGGAATGGCACGGACGCCTGGTCCCGaatcgcctccagcgccaactcCGTCTCGAGGATGtcgtgct
tctccagcagcagcgtcttggtcgtcggTTGGCTCCGGTCACCACTTTCACCGCCTTGTGGTGTGTCATTTAGCAAGATATGCGTCGAGTTCGGGTACAA
TTGGCCACTCgtacgcagcagcttcatctcgtcgCGAAGGTGGCCGAGATACTCCACTGGGAAGGCGTCGCGCACCACGAAGTAGCCATCTCGAAGTAG