Description :
From Genome Similarity Track
Location :
Scaffold_335:4577- 6943
Transcript NameFunction/comments
Aphin_H310_15006Hypothetical protein

Sequence
2366 bases(100 bases per row)
AACTCCTCGAGCCGTACCAAACAGTCACGGATGTCAACGTCCGAGTCCACCACCTCATGCAGCCCCGATTCACGACGTTGGAGGCTCGCCTCTGTCGCGT
CCAAGTGACGCAGCACGTCCGCATTCACGAAGCCGTGCACCGACGCACCACCAGAATCACGTGGTGAAGGGATCCCGTGGACGCGAGTACCTCCTCGCGC
TTCCGAACCGTCCTACACAATAGACGTCAATACTGGATATTCCAGCCGACTCACCGCTTCGCATCGTTTGTCAATCGTACGACAGTGCTCGAAGATCTGG
CGAACGAAGTCGCGACCAAGCCGAGGCAACTCGGCACTACACTTAGCGAAATTCGCTAGGTGTTCCATCTGACGGGAGAAGAATGGGTTGCCTGGCTCTG
GTTTGGTTTCGAACCTCGTGCGCTTGATTGCCTGAAGAAGCACGTTAAAAGGTCAATTTTCTTCGATATGTCGATTACCGACGCTGAGTCGGTGACGGCA
ATACGTCGGATGGCCTGCTGCAGAAGCGCGCCGCGATCGGCAGGAATGGGTGCTCAAGTAAGAAGCACAAACCGTCGTTCAGTTTGTCATCGAGCTGTGA
AGCCCATCATCGAACTGTGAAGCCCGAATCTCTACGCTTGGCGGTGGTGGTGCTGATGTCAAGGAACAAGCCGAAGAGAATGGGCGTGCAACTATTTGTG
CGATGGTTGCGAGAAAGCACTGAAGACACATGCACAAGTGCGGGTAAACAGTCGCATTGATGGCCAGCGACAACCAAGCGACAATCTCGTGGGTCCCATG
CTCGTGATTCAGTGTACTGATGGGGTTACTTCTCGTGATAATCTACAATGCGTTGTTGAGGGCACTGTGCCTGTCAATGTCTAGCTGCTTAGTTCGGGTG
CAGACTTGTCTGTGGTGTCTGATGGTTTGGTTTCTGCTTTGCATGCCGCTGGTGCGACTCCTGAGATGACGGATGTCGGCAGCATGAGATTGCAGCCCTA
CGGGGCGAATGCTCAACCAGTGCGTGTAACGAAGCAATTTCGGTTGTCTAGTGTCGAATTTAAGACGGCGCATGGCGGGTTGCTTTTGCGTGGCCTGCGT
ATGTGGGTAGACGAATCTGTATCTGCTGTGGAGCTTACGCTCGGTGCGCCTATGATGAGCAAGCTGGGTTACGACAACAAGGATTTGTTCGACAACGCGT
CCCGTCATCAAGTAGTCTGGGATTTTGATGATGGCCTGACTGCGACGACGGGTGCGGCGAGGTACCGCTCAATGCGCGTCGCCGTGGTGGCAGATGAGAT
TGACGGTAACGAAAGAATGTGTTGTGCCACGCCAGAGCTGTCTAGCGTGTTAGACGCCGACAAGCAGAGTTGTGGTGACGTTGCTGCGGTGAGCGAGTTG
CATACGGTTAAAGTGGGCGACACAGCCGCCGAAGGGCTGTGAGCCGCGAGTGTGGACGCGCTGCGCCATCTTGTGTGCGATTTGGAAACGATCCGCCTGT
GAAAGTTGAACCGCTCATGGTGCGCCTCAAGTCGGATGCTGTCCCGGTGAAGTCTGGCGACTCTACCCGCCGACTCACGTAGCGTATCTGGAGAAGCACA
TGCGCGAGCTTGAGGCGGCGGGGCTAGTCTACCGCAACACTCGGTCGCGATGGGCTGCGGCGGCGCGGATTGACTCAAAAAACGACTCGGGCGACTTGTG
GATGACCGTCGACTTACGGCCGGTCAACGCGTGCACGGAACCGATGCCCAATCTGGAGGTCGCGATGTCCGTCCTGCAAGGCTCAACGTGCTACTTTACG
CTCGACTGGATGAAGGGGTACTGGCAGTTGCCTCTGCATCCGAATTCCCAATAATTCTACTCCCTCATGACACCGCTTGGCTTGTTCACCCCCACGCGTG
TCTTGATGGGCAGACTGACGCCATCGCGTACTGCCAAGGCGTTGTAGACGAATCGTTTGTAGATTTGCTAAAGCATGGTTTGCTCAGATGGCTTGATGAT
CTCCTCGGGTACGCATGCACGCCTGAGGACCTGTTGGAATTGCTGCGCCGTGTTTTAGAAATTTGCAGGTCCTATGGGGGCTCAAATTACACCCGGGTAT
AAATGTGTGCGAAACTGTACGTTTTGGTGCGGCAAGCAAGTCACCGAGCATGGAGAGGCCTGAACGCGTGCAAGGTTTGTGCGACCTCAAACCGCCTGAT
ACGGCCGCGGCCTTGCAGCAGTTTATGCGTGCCACCAACTGGATGCGAGCGAATGTCCCGTGCTACACTGAGCTTGTAGCTCCGCTGACGAAATTGTTGT
ATGTGGCGGCGAAATTGCCAATGCGGAGAAAGAAGTCCGCTTTGCGGCGAGTGTCTCTGTCGTCTG