Description :
From Genome Similarity Track
Location :
Scaffold_584:4577- 5585
Sequence
1008 bases(100 bases per row)
CCTTCGTATTCTTGGCTCAACACAGCGCGGACAACCCAGGGATTCGCGTGAACGATAATCACGAACGGCTTTTCCCTATTGCGGTGTCTGAGCAGTGGGA
TAGACACGATCTTATGCTTCAAAATCTCAAACGCTGCCTTGGCTCGGCTGAGATCTCGGCCAGCTCGAATCTGCTCATCGATCAGCTCGTAGAGGACAGA
GGCCACAACCGGGAGGTCTTAAATGAACTTGTTGTAACAGTTCAGACTCCCCAAAAATGACTGAACCCCTTTTAGCGTCGACGGGAACGGGAGTTCTCGT
ACCCCTTTTGCGATGTTGGGCTTGTCTGTGATTCATTCAATCCCAGTTTCATGAGACAGGTAGAAAATCGTCTTCTTACCAAATTCACTCTTGGGCAAAC
TCACCGAAATCCCCCAGTATCTCAACCAATACAACAGCCGATCCAAATCGATGCACATCTGTTCGCAGGTCTCAGCTCTATACGCAATATCATCAATATA
CCAACTTCGCCCTAGAACTGGGTTCAGCACAGGTGGAGCCGGGATTTTCCTTCGGAATACTGTCATTTTCTCTGATGGTTCACGCATGTCACTTTCCGTA
TCTGAGGGGTCAACCGTGATCCCCAGAAACTCCAAACGTCAGCATTCACTTGTGCTTCCTTGCTGGACGGGAGACGCACAAAGCCCCAGAGGCAGTTTTC
CAGCATCTGCTGATAGATGAGTGGCGCGTTATTCAACCCAAATGATATTCGCTTCCACTGGAAGTGACCTAACGGGCAAATAAACGCTGATATATATTGG
TTCGGACAGTCATTGGCACGGCCCAGAATCCACTTGTCATGTCCAAGCTGAGAAACCACATCGCATTCTCAAACCCAATCAACAGATCGTCGATCAAAGG
CAATGGGTAATGCATGAGCTTGATCAGCTGGTTCACCAACCGGTAGTCAATACAAAGCCGAATGTCGACTcggttcttcttcatcacaATGACGATCGGT
GACGCCCA