Description :
From Genome Similarity Track
Location :
Scaffold_68:45764- 50249
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_68-snap-gene-0.38Nuclear export factor

Sequence
4485 bases(100 bases per row)
CGCCAGGTTGTAGAAACAGTGACGCTCAGATCGCCCAGAGACTCGAAGAATGCACCGTAGATCTCGAGAAAGATCCGTTTCCATGGCAACCGCGCAGCAG
CCGCGTCAGCGGCGATCGGCTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGCTAGCTGGTCGTGAACTGGAACCAGCAGATTGAAGACCAATTTCT
TCAACTCGAAAGTTGACACTTTGGACGAAATTGATCCGCAGGACGCTGACGAAAAAATGCGATCAATAAACTCGGCGATTTTGGCGAAGAAGAAGTTGCA
GACTCCGTCGCGTTGGAGTGGCGCTTGTGATGCCAAATTCTCAATTCGTTGGGACGCGAGAGTGGCAAGAAGGCTCTCTATAGCTTGCCACTGATCACTC
GCATCCACCTCCGGTTTGCTAGCGGCATTCTGGAGCTCTGGGATGATAAAACCAGCATATCCACCTGGCTGCAGCTGCTGGGAACGTAGCTCTTCATAGA
CCTCTTGGATCGATGATCGCGCAACTTCTTGAATCTTGTTAGCCGAAGAAAATCCGCATCGCTTCATCGCAGAGTTCATAGATTCTTCCAAAAGCTCTTT
CAAGCCAATGCTCGCAGACTTCGGTGGCGGGACACAACGCTTCGATAGCGATACAATGGCCTGTGCTAGCTGATCAGCTAGCGACTCGTTCTTGCTTCTT
GACATCAAGGTGAAACTCACATCCACGACTTGCGCAAACTTAGTATGCAGCTGTCGAATTGATGTCTCGAGGACTTCAACTGTGTGTCTTGTCTTTGCAG
ATGGATCAGCATTCGCAAAGAGCAGGGTCGACACGACGACTTGACTTTGTTTCGGTAGCCTTGCAAACAGCTTCTCGGCGCGCTGCAGCCAGCGCTGGCA
CTTTCCGGTGTCGAGGACCTCGCTCAGTGGAACCGATAGCAGCAGCGCAGAGACACCACTCAGAGTAGACTTCTGCTGTTCTTGACCGCTGAAGTTGTCC
AATGAAGCCGCACCGATGTAGCGACAGCATACAGCCACGTCGCCATCGTTGAAATCTCGAGGCGAGGAGTGGAATACTTGGAATGGTGCACTGTTGTCGG
AAATGCCGAGTTTGGAAGCACACCACACGCCAAATGAGGATGTCTGGCCGTCCACGAGATCGCCAACCACAAGCTTCCAGTTGATAGTTGAAGGTGAATC
ATCAAAGCTGTGTTTGTTGCGAAGCTGCGGTCCCACAAGAGACAGCACATCCAGAGAGCTCCAAGAGCTATCTGGGACGGGTGCCTCGCTCGCAGCTTTA
ACATTCTGGATCTTGATCAGTTCATTTGGGTTTCGCAGTCGCGTCCCCACTTGTGAAGCCACTGTTTCGCCTTTAAACAGCCATTGGATTGTGCTCTTTG
GCTTGTACTGGGTCATCAGCATGCTTCCGACAAAGCGCGACGCATCGATCTTCACTGGAGGTGGCAACGCCTTGCTGGCTTTCACATACTTCATCCACAT
GTGGAATCGCAACTTGAGTCTCGCTTGAATCTGTTTCTTGATATGAAGTTGCCGCTTTTTCTCGGCGCGCTCGAGAGCAAGTTGTTCTTGGCGCTTCGCT
TCTAGCGCGGCTTCACGACGCAGTCGCGCCTGCTCTTCAGCAAGTTGCTCCTGTCGTCTCCGCTCGATTTCTTCCGCAGCTTTCCGCTTCACTTCTTCTG
CTAGCCTTTCAGCTTCACATCGCTTCCTCTCCTCTTCGGCAGCCTTCGCTTGTCGACGCAATTCGGCCTCTCGTTCTTGTCGAGCAGCTTCAGCAGCAGC
AGCGGCAGCGGCTTCTTCTTTTCGCCGCTTTTCCATCTCCTCAAGCTCGCGTTGCTTCCGCAGTTGTAGTTCCTTCTCCTGCGCGCGCACCTCATCCTCA
AGCTTTTGCTGCAGACGAAGAGACCTTGCTTTGTCTTCGACTTCCTTCTGTGCTTTCGCTTCAGCTGATACCTTGAGTGCGGTTTCATCGCTTGGAGAGG
CGGCAAGTGAAGCCATAACACCAGCTTTCCGCTCGTTCTCCAAGCGCACTTTCTCCTCCTTTGCCCGCTGAAGCTGTTCGATACGTTGCATCACCATGTG
CTGTTCGTATTCAAGCTTCGCTTTCTTCCTCGCAATCGTCTCCAACTCAAGCATCTTGCTGTCTTGAGCTCCGAATTGTTGGTCAGTTCCAGAGGTCTGG
AACCCAAGTGGCGCCGATGGAGCTGAGTGCGCTGGTTGAGCAGCACGAGCCGGCTGAATAGAAGGCAACTGCTGCTGCTGTGTCGAGCTGTACGACTGTA
GTTGAGAAGCATGGGATGAATAGTTGGCGAATGAAGAGTACTCGTCTTCGTACACTGGACGTGAAGGGTACAGTCTGGCGCGCTCTTTTGTCTCGAGGTC
TTGAATCAGGTGGCTCAGTGGCGGATACTCTTCTGGGTAGTATTCCGTCACGCCGCGGCAAATATCCTTTCGTAGATACTCCCTGTAGAATGCACAGTAG
ATGGCTGTTAGTCCACGAAAAGACACCTTATAGCTCCGCATATCAAACATGCACAAAAAGCAGAAGTACCCTTGCTTCTGGCCGACAAAGACGTGCGAGC
TTCGCACTTCAAGAGGTTTCTTATTCTTCCGCAATTGGATGTCTGAGGGGATTCAGATGGAGACAGCCATATCAGTCAGTATCATAGAGAACAACGACTT
ATCAAAACAACACACACTCCTTACCTGTCTCAAAGTCACCGCCGAATTGAACCATGATGGATTCTCCGTCACTGTCGTCTTCATCTGGTTGCGTAATGTC
AAGGCCATGCTGCTGGCAAACCGAGCCTGCGTGCTCCAGGTCGTCAAAGCACAGCAGCTCCATCAAGTCGACAAGCGGATACGGCTGGTTGCGAAACGCA
CGATTCATGCGCTGCAATGCGCCAGATCGGATGCTTGGAATGTACCGGAACAGCAGACACGATTGAAGATACGTCGCTTGGCGCAGCAGCGAGAAGAACT
GGAAGTAGTCGTTCGTATGGCGCGCAACGAACACTTTCATCGCGAATTTCACTTGCGGACTGTCAACGACAGACTTGTGCAGCCCTTTCACGAACTTGAG
CACATCGAGTCCACGCCCGTTGTCCAACGCACAGAGAATAAAATACGCGCGGAACTCGGCCTCAAAAGGACTGAGGTACCCTGGGTCGCCCGTGTTTCGA
CTCTCATCGTAGAGTTCATTCAGGGATTTGAGCGTCTGTCCCAGCTGCTCCATGTTCTGCTGCGCGACGAAACTTGGAACCTCGATAAGCTCGTGCTCGC
TCAGAATATGGTACCGAGCGACGCGTTCGTGGACGTCGAGCGCAATCGGATGCACCCTGCCTCCAGCGCCACGGTAGTTCTGCAGCACGAAATCTTTTCG
AATCATGCGAAAGCGATCCCAGCAGAAATTGTACAGCTCGATGATGTCTGGCACTCGTGGCGGGTTCAAACGCGGGTCAACTCCAGCTCGTTCGCGATCC
ATGATCTCTTGCTCAATGTACAGCTGTGTGCGTCGCAGCACACCAGGAGGTCGCACTTCCGACGGGATATCCAACTTGTGATCGGCTGAACTGCGTTGGA
ACCGCTTGATAATCAAGTCGCCCTCGCGGCCGGGCTGGTCAGGGAAGCACTTTTCAAACACGCTCAATTCGTCCACGCGGATGTGAAGCTCTCTCTCAGC
TGGACTGCACATGTCGACGCACGTGCCATCGAGATTCACCGCTGAAGACAACTCAGCTTTGCTTGAGTCGTCTTGATTGTTGTTGTTCGAGCTACCACCG
ATTGGCGAAGCAGACGGAGTCGGGATGAAGTCTAGAGCCGACGCACGGAGATTTTTCTTCCTTAAGTTGGCATTGTTCCCGCTCGTGGCGAATGCTAGGA
TCTTCTCTGGAGGAAATGGGCCAGAGTCGGTATCGCTATCACCAGCGAAAGACTTGTTGATCGTATTCTGCGGAAGGAATTTCTTGGACGGCATCATACC
CGATTGCTCGATTCCACTGTTGCCGTTGCCGTTATTCACGATCGGTGTGTTCTGAAGACGTTTGTTCTTCCCCACAGACTTCTTTAAGCCACCGCTGAGT
CGTGCTTCCAAGGCACCGGCCGCACCTAATCCTCCAAATCCACCACCATCGGAAGAGGTGCCATTGTTCTCACCAAATGAGTTTGCTGCTGCTCCACCAG
TCGCTGGCTCTTTTCGTCCTCGCCCAAAGGCAGTCGCAGTAGCACCATTCGCACCTGGAGAAACTCGAGTTGGATGTCCAAATGCAGTGTGACTGGTGAC
GTCTGTTGCTCCTCCAAAAGGTGGTCGACTAGCGTTTCTACCAGCAGCAGAACCAAATCCACCACCTGAGCCGAAGGGGTTGTCTCCAGCTGATACATTA
CCTGCACTACCTGCTGGAGAAATAATCTTCCTTCGCACGCGCACACCAGTCGACTGGGTTCCAAATGCTGTTGATGGCGACAACG