Description :
From Genome Similarity Track
Location :
Scaffold_7:457498- 459462
Transcript NameFunction/comments
Physo_129308reverse transcriptase

Sequence
1964 bases(100 bases per row)
GTACGGCATGAGCAAGCCCACGTAGAAGACGGGGTGCGTCCGCATCTTCTTCGGAAGATTGAGCGTGTACGCAAGGCCCTTCTTGGCCACATCCTTGAAA
GGTCCGATGAAGCGCGGGCGCAACTTCGTCGTGAAGACGGCTGATACTGCATGTGTAGGTAGGTTTTTAGTATTAAGCAACACCAGGTCCCCGACCTCAT
TACTTTCAGCATTGCCTCTGCCCCTGGCATCTGCATGTTCCTTTTTCTTATCTTGGCGTCAGCCGTTGCGTCACGCATATGTCGTAAGACACTCAGACGC
GTCGACAAGAAAGCGTCAATCTGTTTACGAACATTAGCCGGCTAGCCGATCAGCTAAATCGGCTTCTCCTCCCAAGCCCGAGGCCACCCCGTGGCGGCGT
CAGCGGGACATGAGACAAGATGTTCACGTAGAACGGCGTGTAGCCTGTCGAGGCGTGCACGGCGTTGATCAACGCAAACTCAACGCGTGGCAGCATGGCG
CTCCAGCGCTTCGGCGTCTCGGCGCAAATGCTGCGGAGCACGTCCTCGACGACGCGATTTTCGCGCTCTGTCTGACCATCGGTCTGCGGATGGTCCGCCG
TGGACATGTCCAGCTTGGTGCCAAGCACCGCAAAGACCGCGCTCCAGAAGTTGCCCGTGAAGCGGGGGTCTCGGTCCGAGACAATCGACTCAGGGAGTCC
GTGTTGTCGAAACACTCGGTCCAAGAACAGCGTTGCTGTACCTTTACCATCGATGGTATCCGGCACAGCCGCAATGTGAGCCATCTTGCTCAGTCGGCCC
ACGAAGACCACGACTCCAGTGTTGCCCGCCGCGTCCGCCGGCAGGCCAAACACAAAGTCCATACTCATGAATTGCCAGCAGCCCGAAGGGACAGGCAAAC
TCGCCAACGGCGCTGCAGCATGAGGTGACGACTTCACTCGCTGACACGTCTCGCACGTGCGCACGTAAGTGATCGTCCACTCGTACATCTTCGGCCACCA
GTAGTGGGTGCTCACCGAGCTGTAGGTCTTCTCACGGCCAAGATGGCCGGCCAGCGGCGTGTCGTGTGTCTCATAGAGGATGCGATACTTCAGATCCTCA
TCATGAGGGATGACCACGCGGGGCGTATCCTCGGGGCCAGTGTTGTAGAACAACAGGCCTCCATCGAGGGAATAACGGTGTAGCCGCGCGCGCAGCCGCG
CTCATGTCCGAGTCTTGAAACTCCTTGCTCCCCAGAGCCTTCAGCAACGCGACACAAGTGTCGTCCTTGGCATAAGCCGTTCGGATCAGATCCGGTAATG
ACGAAGTCACGGTCGTTACATGAGCCAGCTCATAATCCGGCCTGCGCGACAGCGCGTCCGCAAGGACATTCTGCCTGCCAGGCTTGTACTTCACCTCGAA
GTTGTACTGGACAGCCAGCGAACCATCCTTTGCGAGAGATGAGGCGACTGAGTCGCAGTGCGTAACGACGCATGATCCGTGTAAATCACGAACGGCTGAG
AGCCCAACAGGTGAACCCTGAACTTGACGAGCGCATACTTCAATGCAAGTAGCTCCTTGTCGTGGACAGCATAGTTATTCTCCGCAGCCTTCAGCTGGCG
AGATTCGAACGCCACCACGCGCTCGCGCCCCTCGGCGTCTGCTTGCAGCAGGGCACAGCCGATGGTAAAGTCCGAGGCGTCACAAACGACACTAAATGGA
CGAGCGGGGTCTGGCAGAGCCAGATTAGGCGCATGAAGGAGACTGTCCTTAATTGCCGCAAACGCATCTTGATGCTCGGTGTCCCAACACCACTCTGCAT
CCTTCTTCAGGAGATTGGAGAGTCGCCGAGCCATCTCAGCGTAGTTCTCGCTGTACTTGTGCAAGTAATTGGCCAAGCCAAGCCACTTGCGAAGATCCTT
CTGGTTCTTGGGAACCGGCTAGTCAATAATGACCTTGACCTTGACCGGGTCGGCCCTCAGGCCG