Description :
From Genome Similarity Track
Location :
Scaffold_45:457412- 459124
Transcript NameFunction/comments
Aphas_H257_13365AnaA protein

Sequence
1712 bases(100 bases per row)
GTCGTGGCGGTGGCTGGAGAGGCTTGTCCAGTGGCACTCAAGGACTTGTGGGCACCAAGGGTCAAGTTGTTCAATCTGTACGGTCCGTCTGAGTGTGCGA
TCATGTCCCACGGTACTCGACTGAGCCTGACGGAATCCATTGCAATCGGGTCGGTGCTTCCCAACGTCCATTGCTACGTGTTGGACGACAACCACCGACA
GGTCCCATTTGGCATTCTGGGTGAATTCTACTTGAGCGGCATTTGCGTGTCGCCAGGCTACATCAACTTGCCGGAAATGACGGAAGAGCGATTCTTGGTG
GACCCCTTTGGCCATGGCCGAATGTACAAGACAGGGGATCTGGGTCGTCTGCTGCCCAATGGCCAATTCGAAATCGCTGGCAGACAAGATAGCCAGGTCA
AGTTGAAGGGCTACCGCATCGAGTTGGATGAAGTCGCCAATGCCATGATGCAGCACCCGTCGGTCAAGTCGGCCGCCGCCATTGTCAAGGACAAGACGCA
CCTCGTGGGGTACTTTACGCCGTCCGACGTCGATGTGGTGGCGCTGGAGCAATGTGTAAACAATTACTTACCCACGTACATGGTGCCTGCTGTGTGGATT
GGCCTGGACGTGATGCCGATGAATTCCAACGGCAAGATTGACAAGAAAGTTCTGGTGGGGATGGAGGTGCAGATTAAGACGGAGGGTTTGGAAAGTGACA
CAGAAGTCAAGTTGGCAGCAGTGTGGGCCCAAGTGTTTGAAGTGGATACACGCGACATCGGTCGACGCATGTCGATGTTCTCGCTCGGGGGCGACTCCAT
TCTGGCCATCCGTCTGGCTTCGGCTTGCAATCGAGCTGGCCTTCCTCTGTCCGTGGGGGATATCATGAAGTACAATCGTCTGTGCGACATGGCGCTGCGG
GTTGGTCAGCAAAAGAGGACGGCGTGGCCCCAGGTGCCACTGGATGACCACACCATCGACCAAGTGGTGACGACTTGGCCGGACTACGAAACAGCCTACG
GCACCACCCCCGAGCAGTCGTATCAAGTGCGCATGACCAAGCAAGACCCGTCCATGTGGGTGCTCCAGGTGCCGCTCTCAGGACTGGACGCACAAGAAGC
GTTGGCCGCGTACCTGCATCTGGCCGCAACCTGTGAAACGTTGCGCACGACGTTCGTGGACTCCGCCACCCTCGGTGTGTGTCATGTTGTGAACTCGTCC
GCCAGCGTTTATCGAGTTCAAGCTGAATCCATGCGTGCGTTCTTGGTAACAGACGCTTCAGTTGGGTTTAAACTGTCAGACTCGTCGTTTGCGCGCTTCA
CAGTCGTCGACATCGCTCATCCGTCTGAGGAGTCCATTGGCGTCTTGACGATCCACCACGCTCTGTACGACGGCTGGTCTATCTCCCTCTTGTTGTCAGA
TTTGCTGCACGTGTATCGCACTGGAACGTCGCCACCGTCCCGCCCGTCCTTTCGAGCAGTGATCGACTACTTGCACGCCCAAGACTCGGCCACAACAGTC
GCCTTCTGGACCGCCTATCTTGTCGACGCCTCGACGTCTCCACTCCTGAACTCCATCGTTCCCCATCTGTATGCTTCAGTGGGCTCCGATGGGGATGGAT
CCGTCTCCACCCACGTGCACTTGCCGCAGCTACAGACGCTGGCCCAGCGTTTTGGCGTGACAACATCAACTGTCGTGCTCCTGAGCTGGGCGATGACGCT
GCAGGTCCACAC