Description :
From Genome Similarity Track
Location :
Scaffold_29:45739- 47204
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06946PREDICTED: dynein heavy chain 7, axonemal-like

Sequence
1465 bases(100 bases per row)
TGGATGCACAGCGTGATGCGTCTCGTTGATGTAGGTCGAGCTCGGCCTCGGGATTGGCACGGTCACTTGCAAGCAGCGTGCCATCGATGGACACATGGCC
CAAAAACAGCAGGTCGTCTTTGCTGCACGAAAGAACGTTGCGCTAACGCGATCGGTAGGGCACGATGGACCCCGACATTCGTCCTGTCGAGCCCGCGACC
AAGCGTCCGCAACCACCACGGTAAGAGTCGCATTGCACTCGATTTGTTTTTTAAGAAGGCATCGCCCAAGGTCACTCTTGGCGCCGTCGCAAGCCTTGTT
CCACGTCTTGCCGTCCCCAGAGAAAACAATCACGAGTACGCCGCTCAAACCAACGGCACCGGGCAGTCCGCGCGCCGACCAGCTCTCGGGACTCTCACGC
CGGGCGCGCGCACTCGCCCAGGCCATCGCGCCACTCAGCCCGCGCGTATCGCTGCAAAAGCGATGTGCCGACGCGATGCCGTGGCAGCTCGAAGTCAAGA
ACCAAGACGTTGTGCTCGACTGCCCCGAGCTGGATGCGAAATACCCGCCGCTGCTGGACCCGTTTTGTCGCACGCTGGGCGTCGAGCAGGTCGACGCGAT
CGAAAAGTTTGCATCGAGCGACCGCATCGGGAGCAACTACTCGCTCCCCGCTGCCCACCTCGTGATCCGAAAGCACCTCCCGACCCCGACAGCGTCGCCG
CTCGTCTTTTTAAACACGCCCAACGAGCCCGATGCCATGGTTGGGCTGCCAGCGCTTGACATCGCGTTCCACCCGGTGGCGGCGTCGCCCCCGAAAATCG
AGCTCCCGCTCGTCACGACGTCGGGCAAGCCCGTGTTTTCACCGCTGCCAGCAACGCTCCCCGTTGCAACAAGGTTGGTGACGACGGCGCCCAGCATGGC
CGAGAACGACGGCGCGGCAGCGCGGTACCAGTACTACCTCGAGCACGTCATTAGCACCAAGGACATTGTACCGATGAACCCGCGCTGGACCGAGCACATC
CAGAAGCTCGTGGCGCGGGCGCTGCAGCAGCTTCCGCAAGCGCGGGCCGCGGCGATTCTGCGTGCCATGTTTGACGAGACGGTCGCAAATTACTACTTTA
GTATCAAGAAGGCTGTCCTCGACTACCTCTTGCTGCGCGAAGGAACCCAGCGCCGGCTGCACATTCCGGGTGGCACGCCAGCCATGTATCAAGTCCAAAT
GAAGTGGAAGTGGGGCGAAGGCTACGCGCACGCGATTGCTCCGACCCGCGGCTGGATCGACCGCAAGCTCTTGGCGAAAGACCATTTGAGTCAGTACCTC
ATGGTCCTCGACAGCCACTTGCTCGCGCTGCATTATGTATGGGGTGACTTTGAGAAGCTCCTCCTCGTGGACTTGCCGAGTACGGACGAGCTCGCGTCGC
ACTTGGTGCCCATGGACATCAAGACGTTCGAGAAGCGGCAGCTCACGCAAGCCGCGCACGTCAAG