Description :
From Genome Similarity Track
Location :
Scaffold_12:45737- 47594
Transcript NameFunction/comments
Sapdi_VS20SDRG_04723hypothetical protein
Sapdi_VS20SDRG_04724hypothetical protein

Sequence
1857 bases(100 bases per row)
GCTTGAGAACGTCTGGCCACTTGAGGAGGTACGTGCAGAGGCCGAGCCCGTGCACGACGCTGGCGTCGTTCGCTGCGAGCTCGTAAAAGTGGCTCATGAG
CGTCTGCGGCGTGAAATAGAGCAAGAGATTGGCTCCTGCGCTCGGCCATGCGTTGTCGTTGGTGGGCACGACAAAGTCCTGGGGGACCTCGAGGTCGCCA
TGGAGCGCGTGGTAGGCATGGAGCGCGGCCACGAGCACCGACAGATCGGTGGTCTGCAAGCAGCGCACGCCGTCAACGACGAAGAGCGTCCGATACACGA
TGCGACTTAGTGACCAGACAAAGCCGAGCGCTTCAAGCAGTGCAAACCTGTCGGGCGAGAAGGACTTGGCCGAGATGCGCAGGGCGAGGGCAATTTGGCC
GAGATGAAGGCCGTGCAGGCGCGCCGGCCACGGCGCCGACGCCGGGACCTTGTACTCTGCTGGGACGCGGCAGTGGCCATGGACGGCGCGGAAGGTCGCG
AGCGCCGTCACCTTGTCCTCCCACGAGGTCCGCCGGCGCGACGCCATCGTCGATTGGGCTTGCTTGGCGTCGTCCAATTGGATCGCAGGAAATAGATAAT
ATAGAAAGGCGAAAAAAGCAATAGTTAACAGAAACCAGCATCCCACCACCGGAACGCTGCCAGCCCATTTAGAATGGCTGGCCACTCGGTAGCGGTCTCG
AGGCAGACAACCGAGCGAAGGTCGATGGCCCAGAGGTCGGTCTTGGGTCGCGCAGCTGAGGCGACTCTAGTTGGCTCGAGACTGCAACGCACAGTCGCAT
GGTCGGTGGTCTCGTCCAGTGAGGTCACGGACGCGCATTCGACTTTAGCAGCATCGTGTGCATCTCCAACGTCCTTGTCCTTGCGAGCTGCCTTAACTAC
GTCCTCATCCACAGAGCTACGACCTCGCCTTTCGACTCGAAATCGAGCGCGTCAGCCTCGGCAACGCGAGCCGGCGTCAGTCGCCGCCACCAAGCAACAA
CGTCGGCAAGGAAGACCCTGTGCGACGACCGGCGTCTCGGGGTCTCGGGGACGTTTCTGCGCTCGTGGACCGCCTGGAAGCTCAAAAGCGCTTCCAGTTT
GGTTCTCCATCGCGCCTTGGTGTTCCGACCTGCGGCGGTGAAGCGCGGCTGCTGAGGGTCAACGCAGCAACAGTCCATGGTCAATAATTGACCCATGAAC
AGTCGTTTTCACCTCTGGTCCGGATACAGATATGACGTGGCAGCATGGTACGCATCTTTCATACCATGCGACGCACACAAAATTGCGACGCGTATGTCTT
TTTTGCTTTAATGTACCGCTCAATCTTGGCATTTGTATCGACACATATATTATCATTTAAAATGCGTCGACGCAAATGCAGACCATATCCCGCGAGCTCG
CACTCAGCACGCGTGCTTCTTGGGCACGCGACGCACGCAGTCCGAGTTGAGATTGCGCAAGAGCATCGTTGCAAAGCGGTGGGCGTTGGCTGCCGAGATG
TCGGCGGCATACGTGATCCGAGCGCCGTGCGCGTCATCGACGGTCGTCCAGCCGTCGACGGTCGTGTTGATGGGGACATTGGCGACAACCGAGAGCTTTT
CTGTTTCGAAGCTTACGAGCGTCGGGTCCACGAGGACACCGGCAGCGAGCGGGTCCCAAAAAGTGGAACGCGTCAAGGAACGTTGGGCCAAAGCAGATGG
ACTCGGTGACGTTGACGATCATCGACACGAACTGCGCGTCAGCAACGGACGACGACGCGAGCGCCTCCAGCGTCGCCCGCTCGATCGGGTACTTGTCCGT
GACGTCGAGGCCCACGAGCTTGATGACGCTGGCGGCCGACGACGCAAACACGTCGCG