Description :
From Genome Similarity Track
Location :
Scaffold_9:45725- 46760
Transcript NameFunction/comments
Albla_Nc14013020conserved hypothetical protein
Albla_Nc14013010conserved hypothetical protein
Albla_Nc14012980conserved hypothetical protein
Albla_Nc14013060conserved hypothetical protein
Albla_Nc14013070conserved hypothetical protein
Albla_Nc14012960conserved hypothetical protein
Albla_Nc14013090conserved hypothetical protein
Albla_Nc14013040conserved hypothetical protein
Albla_Nc14013080conserved hypothetical protein
Albla_Nc14013050conserved hypothetical protein
Albla_Nc14012970conserved hypothetical protein
Albla_Nc14013030conserved hypothetical protein
Albla_Nc14012990conserved hypothetical protein
Albla_Nc14013000conserved hypothetical protein

Sequence
1035 bases(100 bases per row)
GACTCCTCTTCGATAAAGCGCTTCAACTCCGGCAAAGCGACGATCAGATTCTCTATATGCTGAAGAGGAGACGTATTCTCGACATTTGGCGCATGATGGC
TGTCATCGGCAGGTAGAAGCGCTCGTGTGTCTAACTTTTTTTGTCTGGCAAAAAACCTGCGAACAGCGGCTTGAATACAGGTGACCGCAACAACTTGACA
TCGACATTGTTTTCTAACGCGAGCGACAGCTCGATGGTGTTTTACGTACTTGTACACTCGAAAAGCCCGAAATCGTCTTTGAATAAACACAGCTGCATGC
ATCATTTTCTCCCATGAGACTCGTAAACGCTCACATGAAATCTCTGCTTGGTCTAAGCTTGCATCATCCTTTGCATCTTGCCTCAGCGATCTCGTCAAGA
TGTGCATTTGTACTTCCAGCTCCAGTCGTTGTATCTGCCAAGCCATTTCCTCTACTTGAGCGCTCTTCGCGTGACATTCACAGCTGCAAGTCTCAACGAC
CTCGATCATGGGTGTCAAGTCCTTTGGTTCATCTTCATCCTCCACCGCAGATGGAATGAGTTGGGTCGGTGTGAGCTGTTGCTGAGCCTGAAGATCCTTG
AGCCGTTGCTCGAGCCTTTGCGTCATCGTTTCTTGTTGTGCCAAGGAATCTATCAAATGTTTTAGCATCTCATCGTATCGTCTATATATATGGAACAGTA
GATCGCCTTGTTCACGACAATGGAAATGCATTTGTCGTATCAGTTCATGAAAGCAAAGCTGATAGACTTTATACTCGGCCAATATCCGTTCGCATCTGAG
GCTGCTGGGATCGCTTGAGCTTTCTTCATGGTTTTGGATCATTTTCTGCAGTGTTTCTTGCAAATGGATGACTTGCTGACGCGTACGTGGCTGAAGGGCT
GGAAAGATAAGGGTCCGCCATTGCTTTTGCTGAACGCAATATGTGCTCTGATGCTGGGCCTCAGGGTACGAATGTACGGGAAGGATGGAATTCGTCTCAA
AGAGATAGAAATTTCGAGGAATAAGCGAGGCTGCT