Description :
From Genome Similarity Track
Location :
Scaffold_947:4572- 8620
Transcript NameFunction/comments
Phypl_g11776hypothetical protein PHYSODRAFT_300584
Phypl_g11777hypothetical protein PHYSODRAFT_351217
Phypl_g11778hypothetical protein PHYSODRAFT_498950

Sequence
4048 bases(100 bases per row)
GCCAGCTTCTTTTTTACTTCTTCGCCCTCTTGAAGACTGTCACCGCGATGGGCGAAGAAACGCGGCATGTACTCATCGACGAGATAGAAGGCAATCTTGA
TGTGCAAGCAGCGAAGCGTTCGATTTGACCCTAGTAATTCAAGCAAAATCTCCAAGTCAGCCCTTCTTAGAAGTCCTGTTTGCAAACGCAGCTCTCGTAG
TCCAGATGTATGAGCAAATTCCGGATTCGATAGCTTCTTCGCCAAGTTTTCCAGACATGATGTGGTAGTTTTTCGGGTCAATAAGTGCAGTGATGATACC
TTGCAAGTCCCTGCAACTGAAGCATCGATCAGCGCGGAGAAGTCGTTGAATTTTCCTGCTCGCAGCGTTAAATGGGTTAACTTTGGGCAGCAATCCATTA
AATCCTTGAGGTGCGGGTTTGTAAATGCCTCACAGTCCAGATTCAGCCTTGTAAGTCGACCTCCTATTGTTCGGAGTAGCGCCAGAGTTGCCGAAATATC
CACCGTCTTTAGTTTTAAAGAGGTGAGCTTCGCTTTTGCGGCAGGTAGAGCGCTTGGACACGTCTGGATAGATGCGACGGAGTGGCGCTTGACAAATCCA
CATCCAAAGCCCGGCAAGTACACACATATCCATTCTTTTCGCTGGTATAACACTAGAAATTCTTCAGCATGTTTCAGCATGACCAATGGTTTTGAGAACA
TTCGACGTACAGGCTCAGCTTCAATCCTTGCATTGCTCTTGACGAAAGCTAAAGTAATTTCAGCCTGTGGAAGTGATACAGGACTGCATgtgagaagctg
cagcatcacaGAGCGCCACTCTCGGTTGAGTACATCGCTTACAACTTCGACGTCCTCTGCCGAGACGTTACACTGCGATAgatcgagatgctggagcttc
gATTTTGACTGAGGGTGAAACACAGAAACCGCAAGCCAACGCCACAGTAATTTCCTCGTATCATTGTGAACCACTGGAGGCAACGCCAGACGGAGttcct
cgagcgactcggTAAGCGGAAGAGCTGAACAGATAGTGCCAAAGAAGGATACATCACAAAGGCGTCGCCCTTTGAGATGTAACACGCGGATTTGCGCGGC
CTCTTCCCTCACGTTCGCCAAATTCCACATCAGCGCTCTAAATTCCCGTAGTCGCTTACTCAAATGCCTCTCCATCGGGTTCCACCCAAAGTGCAGCTTC
AACTCTTTCACAGGGACAGCACAGCCTTCTGTCTGAATCACAGCTGCCACTCCCCTCAACGTCCCCGACCTCTCTAAACAATGATGCGCCGACAAAAAAC
ACTCTGTCACCCGAAACGGTATCCCCATCTTGGTCATCTGCTTATGACTCCGATATTTTGATTCACTAAACAGTCGACTCCATCTGTTGGCGTCCCCATG
TGGACAGTCCACCCCACACACAACGCACTTTGGCCActtgtcgtcctccacgtGTCTGCTCAAAATCTCCATCGTAAGTCGAAGCCCAGGGCTGTCGCTC
TCCTGAGCTTCTTTGACCTGAATCAGCTCCTCCACTAGTGCAATGGCATCGTGATGACGTCCTCCGAATTCCGCGTCCTCCACTGCGAGTAGAAACCTCA
GCGTGTCGTCTGAAGGTGTCGGGCGTCCTCGCAGATGCAGATGCTTCCACTTGGCAGTCcactgcggctgctggtgctcgaaCGTCCCATCATCGGGCCA
CACTTCGCTCCAGAACTTGGGGTTCTGCGTCAGGGAGAACCCGTTGCAGGCTGCCAATACCGTCAACACGCGCAGACTCTCGCGGAtgttgcgcagcacc
acgttCCCTGTCTGCCCCGCGGCCATACGTGACGTTAGCGCCACAACGACCCACGAGTACGAGGGCGCGATGGCCTCCAGATCCACGCGCAGCGACACGT
CGAGCGAGCTGATGGCGGCACGCGCAATGCGgcgcgccgtctccagcggcagcggcggcactTGCTGCATCTTCTCCGCGTAGGCGATATGACGCGATGG
TTCCTTCTCTCCCAAGGGTTCCATATCCCgttccacttcaacttgagccCATCATTTCGATACGAAAAAATGTCGCCCGCCTTCCGAATCATCCGACGGC
GTGCTATCCCATTGGCTGCTACTAATCGGTTATCTGCCAATGACATCGTCCAACACGTGGCGACGGAGCAGATGCCAGTCAAACTCCCCCCTCCCACTTC
ATAGAGAGACCTACATACCCGAGCGGAGTGTAGTACAAGATGAGCAGCGAAGAGGCCGCCCCCGTTGTCGCCGCcctggaggagatggagatccCGGACG
TGATCGAGCGCCTGCCCAAGCCCGACAAGGCCGAGCATGACGCCAAGATctccgtgctggacgccgccatcaagcagctgcaggcgcgcACGGCCGTGAT
CCGCGCCGAGatggacgcgctcaagacgaaCCGCGGCGGCTACGGCGGCCAGAtccaggaggccaaggccgcattcgcggcgctgcgcagcgagaaggac
aacctgatccagcagcgcaaccaGGTCACGGCCCGCCTGCGCCAGACccgcgacgagaaggactCGACCGTCAAGCAccagcgcagcgcgcgcgccaacC
TCAAGTTCGGCTCCGAggccgagttcgacgccGCCATCTCGGAGCTCCGGCACAAGCAGGAGACCAGCTCCATGTCGctgaacgaggagaagcgcgtgat
caaggagatcgagcagctgcaggcccagaagctgcaggtcagcgccttctcggGCGACCAgggcgtcgtggacaagcagaACGAGAGCATCAAGGAGACC
CGCGCCCTGCAGGCCACCAAGAACGAGGCGATCGACGCCGTtcaggagaagctcaacgcgcagaagctggcgctcgacgagctctaCCGCCtcaacgagg
aggagaaccaGAAGGACCAGTTCCCCGTGCTAGCcaaggagcgcaaggagaTCAAagagcagctggacgacaagtTCACGACGCTCAAGGCCCTCCGCAA
GGAGTTCAAGGAGGCCAACGACAAGTACTACACCAACATCCGGCTGgtccgcaagaagaaggagctcgagcgccacaaggaggaggaggcccgCAAGACC
GAGTACGAGGCCAAGCTCGCCGActacgagaaggagatggcCAAGATCCACCCCTACCAGGACGAGATGGACCTCTGCGACGCCCTCGTGACCTTCATGG
AGAAGACgtacgccaaggagctcaaggaggaggacgtcgagACCGCGGAGACCTCTGCCGCCCCCGTGGAGCTTGACGGCATGAAGCCcatgcagcgcaa
ggaggaggactTCATGATGCTCGGTGCCAGTAAGAAGGGCAAAAAGGCTCGCAGCGGTAAGAAatcgaagaaggccgccaagctggTCTTGCCGCTCGCG
CAGATGGAGGCTTTCAGCACCGTCGGCCTACTGCCACCCACCGCTGTGGGTGCCGTCTCGGAGTCGCTGGCTGCcgtgaaggccaagaaggtcTGGTTCA
ACGAGCAGACGTCCCGCGCCAAAACCAAGAAGcctgctgaggctgctgtcGAGGCCGGTGCCGATGCCCCCGCCAAGGTCGCTtcccccaagaagaagag
caacaagaacaagaagttCAACGCCAGCGACAAAGACGCGTTCCCGTCGCTCGGCGGTGTCGTTGCTGATCTTCCTTCGTGGGGCCCGGGTATGCCTGCT
CCCGTCGCCTTTGAGcccgctgtcgctgctgagtTCGCTGATGCCGACGTCGTGACGGAGGACGAGTAAGCCTCCTCGTAGGGAGAGGGTCTAGCTCAAG
TGTGACCGACCACCTCTGGACAAAACAACAGAACGGGAGCAAGCACGCATAAAGGGAGAGGGACGCTCGCTTGTTTCCAAGGAAGAGCTTGTGACGCCAC
TTGACTTTTACTGTAGCGCGTGGCTGCTTCCACACCGGTAGTAATACAGTAGATACTTCCAACGTTTATTGAGACTGTCAGCGTTCTTGGCAGCTGCTGT
CAACCTcagcgaagagctgctgcatccgttcgttcttgagcttctcgc