Description :
From Genome Similarity Track
Location :
Scaffold_18:457067- 460691
Transcript NameFunction/comments
Phyca_LT1534506241Hypothetical protein
Phyca_LT1534110390AlNc14C407G11425
Phyca_LT1534110573AlNc14C396G11331

Sequence
3624 bases(100 bases per row)
agtaaaaacaaaacatgagcagcagcaagtgctagttttgtcgatgccattgccaaatcgttcaatttcgagccaagtgcttggacaacccgagggtcga
gctggtgcaattgcctcttgtcagttcgagtagatccagcccagtcttgcaaccactgcagtgccaaccaaacatcaccttcgccaccgtctaagagtgc
taaaaaagctgtacacaaacgcgttacgtgccattgtagacagagtctccatgcacggggtattaatcagcgacattgtacgtcgtagcaacgctacatc
atcttcgactacgcacaagcggaacgcgagctcaaactcgccacactgggcggcctccaaagcagcttcagctctagtgagctcgaaactgcacgaagtc
tccaagtggttgttacgctgcgaatcttccgttgttcgagacggtcggtgtctagggagctctgtttgaacgatatcctcgtgttgtccacgccgagatc
gtagctgttctctctgcttggctgcgaattgttttaaacttgtgacggtttgtagtgcctctgtagctggttgtgcccgtgtaggtttgtcggaatccga
cactaaacgagatccttttctttgcttgctttgaacctcactctcctcattttgctgaggttgatcagtttcgtccgcatattctggggcgaaatagtcc
atactcgaacccttaaaacgttcgtcttcttgaattggtgtagtaggctgaggagccggcgaaagttgtccattatcacccgcttcaactattatacctg
aatcagccttatcatcgacggtagcttcatctgttggcaaagcctcatcaccttctccatggtcgaaactcttatcttctgtcgagtcggactgtaatag
catggaagtgctcttcgagtcatctggcaccgaaatggagtcacgaacactaggtttcgcccattgtttgcttgtaaacgagtaacctggtggattgggc
ggaacgaagtcgtagctgggaggagctttcacttgaagctcgctacctgttcgtggatacattttctccagacattcaaacgccatagttgctgggatag
cagcttcacgaactagagatacagaatcatgacgaccggctaaaacgagagctcgaactcgctcctgaagccacacaaacaacgcaagtgagactcattt
tcaaaggaaaaataaaggcaataaacctaccaattgtgcttgaaagtattcttttccagtttcaaccgagatacaccaagcagattcctgcaagacgaat
atatcgaacagtagagtcaagagctccatgccccgtttccgtagcatccagtcgtctcgaggtccacactggaaggcatcctctattgcttcgtagattg
aaccaatgtacggtgaaaaatcatcacctagctgcgtaaaatctcccttttcatgagcatttcgtaccaattggcaggccgattgcagcaggaggaataa
aggggaaaacgcagaaaacatcgtactcccatccatcttcgctacagtatcagccagaagaatcttgaagaacggacggattcgagtagcatgagcgaga
attgtactgggacctggtactgaaactccatcaaagtcaagaggatggagcaaaccacacagacacctagtggctgcttcacccactgcgttggtctctt
tcgcgaacacggcagccactgcttcgaacccttgaatagaactgaattcacgttgtcttcgaggggatgaaacaccggggagagagatcattgggcacgg
taagacgtacaaggcaattgccgagaccaaaattacacacgcgtccgttatcttggcgtgtctgtcacgaagacgaagacaagcgtatgataaaatccgt
ggcaagagcttcgccgcttgaaccggatggcatcgacaaagggctgcaatgagcaggacgagcattcgtcgcgttgaggaacggacgggtttcttcaagt
aaagttagcgtttaacaatctttacaaacgaaacagagcattttgtaccttgtttttctcgatcaatccatacacctcctttaccattgctggatctagt
ccgggtgataactcactgcagaggggcaaactatttcgtaagagaagactccattttcgtagcaaattggtaattacttacatgagtgtcgcgaaggctt
ggtgttgcgtgtcacgatcttctaagcggccgattaaaacgtttaaatgacacatttcttgaacttgtcgctccttggctttacggtccagctttttctt
cttgatcgctcctttgggactcaaactgccttttgctaaactgctgcctccaagttgtccagtacggcttgcagcccgtcgttgaaaattcgactccatc
atctttacttactcctttagaatgaaaacttaaccaaacccaatgagttcctgaatcctctttgcgaaaagtgtttgcagcttcccgacagaaataccag
ttatcctcagtcagggctaaattgagatgacagccccaacgtattgatggtttatgcctgatcaagaccgtcggcccacttcccacctgtccctgttgga
tccatggggtcgatagcaccattatcatgcttatgccgcttcttttcgtgcctttgtgtgtcagaaagttgtacacctgctgcaggtcgtttgttcgatg
aggcactcgaactgtgagtcgagtgtgcttggccgttgtttgccttcgcattcccacagtttttcaggatgctgtcaagttttgccttcgcttcaagagc
ttgagctgccacagtgtaacgtcagctttcgagtatccatctgaactagtatcacattgcctcacccaacgatacgctgcgagcaaccggccgttcccac
gatgtctcgtttgttgtccgattccagaagtagacgtccccacttgccggatcacgtacttcttcccagtccctacacacaaaatacaagcatgagctcc
aacactgaatatcagccaccacaacttaaacatactcggccgactgatcccctgtcgtcttcgtctctgtggccttcacttctgtcggttgttcggaagt
acttccaggtcgctcccacgccgtctcgttggtcgactacagccacaacacgtcaattaaatcatctccaacacaccaaacaaccactacctacctcgtt
ccaatagtacacgtctcctgtcgcaggatccaccacctcctgccacagttgaggtacggcgttatactctgtcgaaagcgacaccatattgtagctctcc
atttgttgctcgatccgctgtgttttctgcaggtcctgcgctcgtcgaagtgcaactgcatggagcgtattgtccctcacacgagggtcgaatttatcgg
cagctgatggctctgtaagctgtgaaccggccactcgacgctgagctactgaggtggttgcattggctgtctgtttctgtcgtaattgctgctcctgagc
cagttctcgctggctaggaccacttccggtagcttgaaggtactttagagcttcggcacgagctttttgtgcagctagttccttcttgaggcgacctcca
gtgactgcagactttggcggcatt