Description :
From Genome Similarity Track
Location :
Scaffold_1973:457- 4614
Transcript NameFunction/comments
Phypl_g14482hypothetical protein

Sequence
4157 bases(100 bases per row)
GATCAAGATCCGACGGCGCTGCCTGATCAGGACCCCAGAAAGGAGGTGCCTCTCGAAGATGAGTAGATCTGCTATCACGAGGGTGGTGAGCTGTTTGCAG
AAGATGTGCAAGGTGAACTGGCGGTGGTGCCTGAAGTCACACTGACGACCGACGAGGTGACGATTGAAGATCTTCAGGTGGGAGATCCCACGATCAACAC
ACCGGAAGAGATCGACCGCCTGCGGAAACGGATCTGGCGATGTCGACATCTGCTGATCGGCAAAGGCAATGCGCTGCCTCCGGCGGCGCGGGGGTCGTGT
GTGATGTCGACGTAGGCAACGCACGGCCGATCGCACAGCGGGTCCGTAAGGTGGCACCACAGTTCCGAGAAAAGTTGTCAGATCTGATCAAATGATTGCT
GGGAGCCAAGATCATATATCACTCTACGTCACCGTGGGCTTCACCATACGTCTGTGTATTGATTACAGACTGGTCAACGACCTTACTCGACTGATGGTTT
ACCCAATGCCTCTGATCAATGATCTGCTCGAAGATCTGGATAAGGTGCTGTGATATTGTTCGCTGGACATGGCGAGCGGATTTTGGGCAGTGGCGATGAC
GGATCGGGCTCGTGCGATCTCGGCATTCATCACCCCATTTGGACTTTTGAGTGGAGTCGGATGCCTTTCGGCCTCAAGAACGCCCCGCAGATCTATCAGC
GCTTAATCGATAATGCGTTGTACGGATTTACGCGGATCCCGCGTTCTGGGGCTAACGGGGAACTGACAGATCTGTTTGAGACAGGAGAACCTGAAGATCC
TGGTAAGCCTTCGGTGTTGGGTCGTAGATCTTATATCGACGACATACTGATACCGGCGAGATCATGGGATCAACTATGCGATCAAGTAGATGCCCTACTG
GAGGCGTGTGACAAGTGGAACTTATCGATCAGTGTGGTGAAGAGCTTCTGGGGAATGAACAAGGTGGAATACCTGGGACACCGAGTGTCGAAGGATGGGT
TGGAGGCTAAACCCAAAGACCTGACGGCGTTGACTGATCTGCCATTTCCGGCGTCACTACGATCTATGCAATCTTTCCTGGTCAGCCTGAACTACTATAG
TCGCTTTATCGAGGATTATGCGATCTACGCCTCAGTGCTGTACGAGTTGCGAGAAGTTGATTTCACCGCCATGACTAAGAAGCGGACCAGTGACCAGATC
ACGATGCTCCTCGAAGCGGAGACCTCCGGTCGGGATACCACATATCTTGATCTGGGAGATCGGGGTGTGGTGGCAGCAGATCAGGTAGCACAGAACTCCT
CCGATGTGGACAGACGGTGGATCCATACGCACCAAGCGTTCAAGAGGTTGAAGGAGAAAATCACGACGACGCCCGTGCTGCGGCATTTTGATCCAGATCG
CCAGACTGTAGTCGTGGTATATGCCAGCGATTGGGCTATATCAGCAGCCCGTACGACAAGGTATACTATCCGATTACTTTCGTAAGCCGTACACTCAAAG
CGAACGAGTTGAATTATGGAGtggtcgagaaggaggtATTGGCGCTATTGCGGGTCCTGGATCTCACCTATAATCTGCTAGTCGGCCGACCCGTCCGGAT
CCTAACTCGGCATTCAACACTAGCATGGCTGTTCAGATCCGCTGGCCTCCAGGGCCGGTTGGGTCAATGGGCGGCGTTGTTGTCGCCTTGGACGCTCGAG
ATCGTACGATGCTCGAAAGGAGAAGACGAGATCCTGggagcgcttgctgccagtATCACGCCCAGATCGGAGGTCGACAAGGGCCTGATCGCAATCGCCC
GCAAGAAAGAGCCAAGGCTCAAGATCCAAGCCCCGATCCCGACCGTGGGAGCTGACGAGGAACTGTTCGTGTTGAGTTTCGATGGATCTGCTCGAGTCaa
aagaggaggaggcgcctACAGTGCGATCTTGTGGAAATTGCCCGAGTGGACAATGCTGAAAGCCAGATCACGCTATGCCGACAGTCTGACGGTCAACGAG
GCAGAGTACCATGGGCTCCTGCTATGCCTAGATCTCCTCGAAGAGGTAGATCGGAGACGCGTAGTGATCTGTGGCGACTCGAACTTGGTGATTCGCCAGG
TGAGGAGCGAGTTCGATTGCAAAGCGCCGGGGCTCACACTTCTGAGGCAGAGGGCACTAGATCGGTTACAGACATGGCCAGATCATGAGTTGGTCCACGT
AAAGCGTGATTGGAACGGTAGTGCAGACAGCCTGGCTGGAGCAGCCCTCTAGCGTCAGTACGGGATCAAAGTTGAGGACGAGTCCGAGAAGCAAGATCTG
ATTACGTTGAACCGATTAGACGAAGTTCTAGTGGCAAAAACTAAAGATCAGGTAGTACAAATCTCGCCTGTACGAACTAGAGCCAACCCCAGATCCAGAT
CGAGACCCACGGTATTACAAGAAGAGCTCGTGCGGAACCTCCGGATCGAGCGGATTAAACGAGAACAAGACGAGGAGGCGTGGATCTCGAGGTTGAAGAA
GTATCTGGCTGGACAGGTGGGTGATCTGACTCAAGAAGAGACTAGATCCTGCAGTAACATCGCTTCGGATTATGAAGTAGATTTTCATGATCTGCTTTTC
TACTGTCCTCCTACGAAACGTGCGGACGCTGGTCGAGATGGCCTCATGAGACTGGTGGCGCCGGAATCCCTGCATCATGATATCTTGCACCATTACCATG
CGAGCTTGGAGGGTGGACATCAGGGAATTGGCCGTACATATCAACGGATCAGAGGTCATTTCCACTGGCGGGGCCTCTATCGGAGTGTGCATCTCCACGT
TGGAGAATGTGTCGATTGCGAGACCGGAAAAGGACGGCCCACGATCCGGGGAGAGTCGCCAGGGAACATCCAAGCAACCTACCCGTTCCAGATCATAGCC
ATGGATCACATCCCCTCTCTGCCCAAATCCTACGAGGGAAATACGGAACTATTGATCTGGGTAGATCTGTTCACCGGCTACGCAATCGCGAAagcaagcg
cgtcaagaacTGCGCAGACGATCGCAGAATCTTACGAGGAGTGCGTCTTCCGCAGGTTTGGTGCCAGCGAAGTGATCCGGCATGATCGGGAACCAGGATG
TATGTCCGATTTCTTCCGTGCGTTTAACAAAATCCTGGGGCAACGTCAGCGAGCCACGATGGCGTATCGACCTCAGGCTAATGGAACGGCCGAACGAATG
GTGCAAACCGTGACCAGGGCTCTCAAGATGTACGTACAGGATCTAGATCAACGGGATTGGGACGAATACGCCAAACGGCTCACGTTTGCACTCAACACCG
CTCAGGACCGGATCCGCGGGGACACGCCTTTCTATCTGGTAGATGGCTGGGACCCTAGATCCACCCTAGAAGCTACGATTCCGGTAGGAAGCACTCGTCG
CCAAGATCGGGATCCACGACAGTGGTGGTATAAGATCCAACGCTATCACCAACAAACACGGGAGACGGTGAACGAGAAACTGCGAGAGGCGATTGCGGAT
CGAGCAGACCAGCACAACGGTGAAATCCGCCCGCACCAGATCGGGGTTGGATCTCAGGTGTGGCTGTACCTAGATCGCGTCAAAGAGGGATACGCTCGGA
AACTCACACACCTGTGGCATGGACCGTTCTGTGTGTCCGAAAAGATTAGCAGCTATGCCATGAAACTCGAGATCTCGGGGACCGAATATCGCCTCTTCCC
GGTGGTTCATGTGTCAAAGCTGAAGCCGGTGAGGGAATTCCCTGATCGCCTTCAGATACAACTGACGATCGCCGACGCGGATCGGTTTGATTTCGACGAG
GCACTCCTGCCGGAAGACAGTTGGAGCCAGGATCTGGGGCCTGGCGAAtacgaggtggagaagatTACCAATGTCAGATCAGGCAAGAGGACGAGATATG
GCCGAAACTACCGGGAATTCTAGGTGCACTGGCGAGGTTATGATGACCCGACTTGGGTGGACGAAGCAGATCTGAACTGTGAAGCATTGCTACATGAGTT
TCTGCGGGATCGCGCGAACCGCCATCGGTTCGGTGTGATGCAGTCTCATGAGGAACCATGAGGCTGTGATCTGTCGGCGTAAGTTGGTTACGTCGATAGA
TGGACgtgttgaagaagctgcagggtGGCTGCAGACTAGGAAGAGGGGTACATATGT