Description :
From Genome Similarity Track
Location :
Scaffold_1751:457- 3319
Transcript NameFunction/comments
Phypl_g14080hypothetical protein

Sequence
2862 bases(100 bases per row)
AACGCGTAGAATAGGCCGTGCGACTTGGTCGACGCCGCGGCagcctgctgcacgctcgcCAGCGAAGTGGTCATCAGGtccgccacgctggacgGCTCGG
TTGCCACGAGCGCGTAGTCTGGTTCGTCCGACAGCGCCGACTCGGCTGTCTCGATGGAGTAGTACACCGGGTACTTGGCCGGCACGGTCGCTGGCTCGTA
GATCAGCACCTTGTTCACCACCGCGGGGTACACGATGGAGCTGGCCTCGCGCCAGAACCACCAGCCCTTAATCTTGACGTCCGTGGGCGGCGCGTTCACG
TAGCCCACCTTGCCCCACACCGACGTGGACACCGTCAGCTTATCCGTCacctgcacgagcagctcgccatcGCCCCACACGTCCACATCGGACTTGCGCG
CCACAATCGAGCCGGCGAGCAGCTGGCCTGGTCCTGACAGCGTCAACCTCTCCTTGTCCACAGAGCCCGCCGTGGCAAAGCTGGCAACGCCCGAGCCATA
CACGGAGGCTTCGAGCTTCTGAGCGGACAGGTCGCTCGTGTCCACTACAATGTCGCCCGAGCCGGAAAGCGTGGTCTTCACCTCGCCGGCCGCCAGAGCG
TCCGTGACTAGAGCCACCGCACCGCTTCCCGCGACTACCACGTCCAGGTTGCCCTCCAGATTCACCGAAGGaatctccagctgcgcgaggccgTTGCCAg
tcacctccacctccagcgagCCCAGAGTGGCGTTGGAGCCCGACTCCAAGTACAGgttgccgtcgcccacgcACGCGAACTTGATGTTCGCCTCGGCGTC
ATCGAGCGTCACCACATCGTCGttcagcaccacgtcgccagAGAAGGCCGTGGTcacgcggcgcagcaggttcTTCTCGAACAGGTAGATCCGCGTCAGC
ACATATCCCTCGACGTACGCATCTTCGTTCTTCAGGTGGAGCTTGAGTCCGTCGTTGCGGCGCGGGTGCAGGGGAGCGGCCTCGATCATGTTCAGCAGGT
CCGTCGAGTTGCCCGTGACCACgatcttggccacgacggtCTCCTCGCCCTGTGactgctcctcctcgtcctcgtggcggtggtggtgcttgcgcagcat
caTGGTTGGGATCTCGATCGTCTCGCCCGCCAGGCTGCTGTCATCCCAGCCCGAGCCCGCAGGCACGGTGCCGGGCACAAATCCGGGCTCAACACCTGGG
ACATATCCAGGCACAACACCAGGGGTCGTGCCCGCGACGACACCTGGCGTTTCGGCAGCGGGCGCTTCAGTAGTGGTAGCTTCCTTCTCAGGGGCCTCCG
TGGCAGGAGCACCCGGCACGGTGCCGGGCACAAATCCGGGCTCAACACCTGGGACATATCCAGGCACAACACCAGGGGTCGTGCCCGCAACGACACCTGG
CGTCTCGGCAGCGGGCGCTTCAGTAGTGGTAGCTTCCTTCTCAGGGGCCTCCGTGGCAGGAGCACCCGGCACGGTGCCGGGCACAAATCCGGGCTCGACA
CCTGGGACATATCCAGGCACAACACCAGGGGTCGTGCCCGCAACGACACCTGGCGTCTCGGCAGCGGGCACCTCCGTGGCAGGAGCCTCCGTCGCTGGCA
GAAGCGAcgggtccagctccacgaagaCGCGGCCGGGTACAGCCAGGtagagctgctccagctgcgcgtaGCTGGAGACCGTCCAGGAGCGCTGCAGGGG
CTGGTGCTCGCCCACGACGTCCTTGGGAGGCGCCACCTCCGACGCGTCAAACGTCCAcgcgtgggcggcgccgaaGGCCAGCGTCATCGCTGCCACACAC
GCCGAAAGCTTCATGAGAACTGCTGCAATCTATCCGGTTTCCGCGGCAAACTCCAAAGTGGAGCGCACTCTGCCTTGCTCGGAAGCCTTTGGAGCAAGGC
CGGAAGATCCTGAGTTTTCGGTCCCATGCGACAAGCCAGTCGCCGGACTCCCTGCGCCAATACATACATCTCATTTAAGGATAGCATGGGGCAGGTTACA
TGGCGGGACTGTACAGTATCTGTGTATACTTCTTGATTAGATAGCCTTCTGAATCGCATACTACCATGACTCAAATACCTAGCCTCGGTTGCGGCGAGCC
AGATGCAATTCTTATATTGCATGTACAGTCGTGCAGATCGTTTTCGGCACCTCTATAAACGTATATCCGGAGATAGTATATAGATATTGGAATACGTTTG
GAAGTCAAAACCACACCTGAAAACCATTTACTTTTAGGTTTGGATATGGTCCACCCTGCCGAAAACGAGGTACCTGCGAATCTGTTGGGCAGCTCTGGCC
AAGTATCCATCGGTTGTTGTAGTGAGGTAGCTGCGAACGGACCACGTTTCTTTAATCGTATAACCGGAGAAAGTCTATCGGTATGGGAACATATCTTGAG
GTCTAAACACTCCTGAAAACTATTATCATTTCAGTGTTGATATGGCCCACCCTGCCGGAAGTGAGGTGTAAGACTGTAAATGGTACTTTACGAACTTTTA
AAGGAGTTGCTGGTCGCGTCTCACCATGGAGGCATGGCGGCAACGGTATTGCCATGGCCCCAAAAGCAAAGTATCCGCTGCGAGTTACGTCAGCACAAAC
ATGTTCCGACCACTTGTGGACGCTCGTTCTGCTGCAAGCCAGGCTGCTCGCTACAACACATGCCCGGTCGGTGAGACGAGAGTCTCGGACGAGAACTAGT
CGCATCTTGGTGCCCGAGCTGCAGATAGAGAGGTGAGCGCCAACGAAAGCGTCGGCTTCTAATGCTGAGGCAAGCGGCTTGGCTAGGCTGGACGCCGAGT
CTGCATTCGCGCGGGCGCGGCGTGACGACGGATACTCGCGCTACGTCACGCGGGGAAAAGCT