Description :
From Genome Similarity Track
Location :
Scaffold_1384:4569- 8681
Transcript NameFunction/comments
Phypl_g13273hypothetical protein

Sequence
4112 bases(100 bases per row)
TTCCGCTTCCAAGAACTCAGCGAGGTAACACAGCTTTGCTTCTCTTTCAAGACCACTTCACTGGATATGTGATCGCTAAGGCGATGAGCGACACTGGAGC
ACTGGAAGTAGCTAAAACGTTCGAAGAATCTGTCTTCCGACGGTTTGGAGCACCATCGCTAATCCGACACGATCGAGACCCACGATTCATGAGTGAAGTC
TTCCAAGCATTCGCTGAGTTGATGCAATCAAGATCCAGAGCTACGCTGAGTTATCGGCCTCAAGCAAATGGACAACAGGAACGTTCGGTTAAAACAATGA
TCCAGACAGTCCGAGTTTATGTGGAGGATCCTCTGCAGGCTGATTGGGATGATATCGCTGAGAAGATGGTATATGCTATCAACAACTCACGAGGCACAAC
TCGGTGGGAGACTCCGTTTTATCTCGTACACGACTGGGACTCGCAGTCCACCCTGACGGCAATGACGTCGATTATTAAGAATGATCCTGCCAACTTAGCG
GAGGCCACGCAATGGCGCTGAAAAGCAAATCGTCAACGAGAAATCGCTCTCCAACTAGCGAAGGAATACCAGCTAACGGAGAAAGCTCGGCGGGCGAGAG
AGCACAACGCTAAACTCAGCAAGAGAGAACAAAGAGCTATTCCAAGCGCGAGGGACTCGGCGGAAGATACAGAGAACTCAGCGGAAGATGCGATGGACTc
agctggagacgaagatgaagcgaCAGCCAACTCAGCTGGACTACAACAATTGTTGTTCAAAGCAGGAGACCAAGTGTGGCTGTTCGTGGAGCGGGTGAAA
CCtggcttgaagaagaaactaGCCCACCGATGGCACGGTCCATTCcgggtgaagaagaaggttgAAGAATTTGCGTACGAACTCGTACTACCCGACAAGA
GTGGTTACCGGTTCTATCCTGTGGTGCATGTGTCTCGGCTGAAAGCAGTAGCCGATCCGGAAACGAGACCAACGGCGACGTTGGTAGACGAGCTGAGCGA
AGCACAACGtttcgacttcgacgaggaaTTACTTCCTGAAGACAGCTGGGAAGTCAGCGAGGATGCAGACAAATatgaagttgaagctatATTGGATGAT
AAGATGCCGCTCTCGACGAGTACAGATCGGACCCGAAGACTTTTCAAGGTGAAGTGGATTGGCTATGACGAACCAACATGGGAACCGCTAGCAAATCTCT
CCTATGGAGGCCTGTTGTTTGATTACTTGCGACAGAAGAGACGAGAAAATCGTCTACAAATGGTGCAGAGACTTAATAACCACAGCACCGCACGTTGACC
GACACCAAGTGAAGAGGTACAGGCTTGGTGGATCGTGAAAATTACTGAACCCACTTACATGAAATTATATATGAAAtgaactcagctgagtcTTAGGAGC
TACGAACGGGTAAAACTACTCAGCTGGGAGAATGGCCGGAAGAGAGCAGTCAGAACTCAGCGTCGTCCAGAGCGTTCTCGAAGATACTGAGTCCCGCGCG
GTTGGCAGGAGTCAGCGCGTGAGGAGAACAACGCGGTGGACTCGGCTCGGCTTCGTCGATGTCTTCGGAGAGAGAAGCCGCGACATGCTCGTGGTCGAAC
TCGGCTAGAGCAAACACTGGGAACTCGGGATGAAGTGGGAGGAAGCACTGGTTGTATGGGTGCAACCTAGGCTGACGAAGCCACCAAGCACGCCAAGGCT
CCTCACGATCGATATCAGCGACAGTCGATGACCAGTCAGCTGACTCCGGGGACCAGGGAAGATTGGCAGGTGGAGCAAACGGGTACGGCGGGTCGAAGTA
GAGCTCCGAGTCCAGGATAGGGGCTGGACCCGCCGAGTCactcgacgaagcagcttcgtacAACACACGATACATCTTCTCCAACAAAGCGCGCAAAACG
TCACCTCGACGTTTTCGTTCCCGACTGTAATTCAACCACAAGTTGAGTATCAATTCGAGCTCGGCTGCAGTAAGATCCGGATGCAGAGTGGGATGCAAGC
CGAACACCACACTGGAATCGACAATCCAGTGCATACGTTCCCACAGTGCAATGAAAATCTTCAACCAGTCGGGATGCTCACCTCGACATTTGAGCATGCA
CTCAGCGATGATCTCCACCAGCTGAGTTGATTTAGAAGAAAGACCACGAGAACGGACTCGATCCAAGACATCGTCGGACATGAAGAAAGGTCCCTTGGGA
AACTTGGCCCTCAACTGTTGACAAGGATGCTGGGGGAGAGAAGACGTCGGCAAATGCAGCAATACCTTCCATCGACGACGGTGTCGGTCGTACGTAGCTT
TTCCCATCCACATTCTCCATCTGAACGAGCACGATACACGACTTGAGGATCCTGTCCCAACATCGCCGAGCTCCGAAATGAAAAAACGGCGGATTGCGCC
GCATCTTCATCTGAGGAAACACTCGAGAGTCACGAGtggcagcttgagcagctcgacgtctcAGCTGAGCGATTGACAAAAGCCAGCACGTCTGGAAGCT
GCCCCGTGATTGTTGTCGAACCCGCTGAGTTTGAACTCGGCGGCGGAGCCATCGCGGAACTAAGGACTTGTGCAGAAGTAGCCGCAGAAGAGGGCGCGGA
ACTCAGCTGACCCTTTGACTTGGCTGATTTTCCCTCCTTAGTTTACTTTGGCGTCACCACGGTCTTACGAGCCGTAGGCCTCTTCACTACAGACTTCTTG
GCTGTAGCAACAGCTCCATGTCTGCCCGCTGATGAACCAGCCGACGTCGAGGAGACAACCGACGACTTCGCATTACTTCGAGGTTTCTTGACAAGAAATC
GAGGAGATGGCGGGTGTGGCCGCTTAGCCTTTGCAACAGAAGAAAGAACCGGTGAAACCCCAGAAGAAGGAGTCGCCGCTGAAGTACTCGGCGGAACTGC
AGGATTAGCGACTGGAGTACTCAGCGGGACAGAAGGAGAACTTGGCGGAACCAACGGCTGAGTAactggaggagctggaaccTCACCCTTCTCCTCTTCA
CTCTCTTCACTCGACAAGAATAACTCCTGGAGGAGTTTGCTCTTCTGAGCATCAGTAAGAGTCCGTTTCCGCCGAGAAGACAGAGGAATATTCGCTTCCA
AGTCGGATGAATCCTCCGGTGGACTCAGCTCAATGGTAGAAGAAGCTGAGTTGTGCTGCTGGGAAGACTTCGCGTCAATGACTTGGGAGGATCCACTAGT
CGAACCCAACACATCGAAATCCGACGCCTCCAAGTTATCAAGCTGGACCCGACCGATAGCGCTGGCATCCTTGGAAGGAGCCCGTGAAGAACGGCGAGAC
GGAGAGGGAGTTGGTTTCTTCGACTTAaccttcttcgtcttccgaACGCTTGATACCTTGGTAGTAGCGCCAGGCGCAGCGATCGGCTGAGTCGAGTGCG
CCACACTAACCGCCACGCTGGACTGAGCTAGGGACAGTGACGAAGATCGCTGAGTAGTGAGAGGAAGCTGAGTCGACTGAGCAGAGTGAGCTGAACTCAG
CAAAGAtaacgcagcagcagcagattcaGCTGCCAACTGAGGAACGGAACGCTCCAAAGACGACGAGACGCCTGAACGAGTCAAGTCTGGAACAGCAGAG
AGTTGCACCGACGGACTTGTCGTGGGGACAAGACCATCTCTGCGGTACCGGCTTtctggaactcggcgggaCGTAGCTGGACAGGCGGCCGCTGAGTTGG
AACTGGTTGTCGTTGGAATGGCCATCGAGCTGGTGATCGGGGGAGTGGAAGTCACCGGCCGCTGAGTAACAGGAGGCGAGTACGAGTTGATACTGAGAGT
AATTTCCCGAGCATCGCCAGGCTTGAACAGAGCCAGCTCCGGCCAACGCGACTCCAATAACCGACACAACTGAGTGTTCAGGTGAAGATCACTCGGGGAA
AGCCCAGGGGCATCCACACCAGAAGCAGCGGCGATGGCCAAAGCAGGATCAGAAACAGTAATCCTCCCTGAATGGCGGAGGATATTCTTCTGCTGAAGAA
TAGTCCGTCGCTGGGCTTCAATAGTCTCCTGCGCTAGGCGCAGAGATCGAGTCGGACCACCGCTTGCCACAAtacgagctgcttcttggatCATGGAGAA
GTACGAAGCCAT