Description :
From Genome Similarity Track
Location :
Scaffold_791:4569- 5985
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_791-fgenesh-gene-0.1UBX domain-containing protein

Sequence
1416 bases(100 bases per row)
ATTACCAGTGATCTTCTCGACAACGTTCACGCCGCGCGAGACGCACGTGAGCAGCGCCAGGAACGGGAACGTGGCGCAGCCGAGTGAGAGGCTGACGCCA
AAGCCCTCAGCGTGCTGTACACAGCCTGCCCATGACACGATGCAGTCGCTGTCGTTCAGGTACGTGCTCAGCTGCTCGGTGCACAGTGCGTCCCTATATA
TTGCAATAGAATGCAATAGAGAGATAAGTATCACCATCCAGTATCACACGGTACCAAATAAAGATCTCACAGCAATAGAAACACACATACCGGCAGAACG
CGTCGGCGTCGTCGTGGATGTTCGAGTGCAGGAACACCAGCAGGAACTTGGACGCGGTGCGCGCGGTCGACACGGCATCGCGGAACGACGTGTGCTCAAA
GCGTGGGAACACGTCGCCGTAGCGGCGGCGCAGCGAGTGCGTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCGAGACCTGCGGATCCT
CCGGCTCCCCGTCGCCCAACACGAAGCTCAGCGGCGAGAAGAGCAGCTCCACGAAGCCCTTGGATGCGCGGCGTGGGGCCGCTCGCTGCGGCACTGCTAC
TGGCGCAGTCGGCGGTGGCGGCGGCGCGGACTGCGACGAGGACGACGCCGTGTCGGAGTTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCGTCTCCTGCTTGAGCTGCTGCCTGAGGACGACGACGCAGACCCGTCTGCGCGTCATTCGGGATCTCCTGTGCTGCTGCGGCCGTCATGACACTGGGCT
ATAGAATCGAACAAGGCGTTGCGTGGATAGAGAGAGAGAGAGAGAGAGAGAGAGAGTAGAGAGAGATCACACGCCGAAGAGCTCCTTCCTCTCGTGTAGC
TTCTCAAGATGTCGTCCGTGTGAGCGCTTGACGTGTTCGAATGTGAGAATGGCGAACTGAGATGAAGGAGATCGAGGAAGGAGAAAACGTAAGAAAATAG
TGTTTCCAACGCTATTCCAAAACGCATAGCAAACCAATAGTGTGGGTCACATTGTTCCAGAGTAGATATACAGTGTGGTATACAATATTTCAGGCTAGAC
TTACACCCAACATCAACGTCACACATCACATATCATCACAGACAGCTCGCGGTGATATATATCTTGTGAGGAACATGAGAGGAAAGCACGTACACTCATG
CAGCTTCAAGATGGCAGCATGCAGCAGATTTGTTGTCTGCTCTGGCAACTCTAGTCGTTTGCTCCTGATTGTAATACGACTGGGGCTGTATGTGACTGAC
TGACTGACTTAGGACAGACCTCTCTTGAAGCTTTCACTTGTTAGCGCCTTCTCCTGTCATGCTGAAGTGTACCCACTAAGTGGCATTGCCGATCGTATCA
GAGCGCTTCGACAGTG