Description :
From Genome Similarity Track
Location :
contig_10:45687- 47042
Transcript NameFunction/comments
g3254.t1OWZ18625.1 LOW QUALITY PROTEIN: Retroelement [Phytophthora megakarya

Sequence
1355 bases(100 bases per row)
GCGTCGGCAAGCACGTTCAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATTCCGCGAAGAATGACAGCCAGCGGGCCATCCTCTGAGACAGATGCG
GAGAGTTGGTGGCCGTCCGCAAGGACGCGTGGTCTGTATAGATCACAAAGGGCTCAGAGCCCAGGAGGTGTACCCGGAACTTGACAAGGGCATACTTCAT
TGCGAGGAGCTCCTTGTCATGGACAGGGTAGTTCCTCTCGGCGGCTTTAAGCTGCCTGGACTGGAACGAGATGACTCGCTCGTGCCTCCGCGTCGTGTTG
CAGCAGCGCGCAACCGATGGCATAGTCGGAGGCGTCGCAGACAACGCTGAACGGTTTTGTCTCGTCCGGCAAAGCCAGGACCGGCGCGCGCTGCAAGCTC
GCCTTGATGCTGTTGAATGCATCCTGATGACGGCTCTCCCAGCGCCAGTCGGCATCCTTCTTAAGGAGATCCGACAGGGGTCGTGCCAGCCCGGCATACC
CCGCACTATACTTGTGCAAGTAGTTGGCGAGACCCAACCACTTGCGAAGATCCTTTTGGGATCGTGGTGTGGGCCAGGCCGCAATGGCCTTGACCTTCTC
AGGGTCGGCTCGAACGCCGACGCTGCTGACGAAGCAGCCGAGAACTTTGATCTCTTGTGCCGCAAAGACGCACTTGTCGATGTTGGCATAGAGCTTGTTT
GCTCTCATGACCATAAACACTCGACGGAGGTGCTCGAGATGCACCTCGATAGCCGTCTTGCCTTCCCCGGCACGGCTATGGACGAAGATATCGTCAAAGT
ACGTCTGCGTGAACGCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTGAAAGTCGCTGGGGCATTTGATAGGCCCTGTGGCATCACTAGCCACTC
CCAGAGCATGCCGCTCGGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGCGCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTATAA
AGCTCGCAGCCCGCCATGTTGTTCAACAACACATCCTTGCGGGGAATGGGTGTCTGGGCGGGCACCGTTGCGCTGTTCAGCTTGTTATAAGCATGAACCA
GACGCCACTTCCCGTTCGGCTTGCGAACGCAGAAGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACCATGCCTGCCTTTGCCTTCGCGGCGAAGAA
GGCATCAATGACCTCGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACACAGTACTTTGTGCCTGGCACGAGATCAATCTCGTGCCTAACTCCTCGG
TCAGGTGGGAGTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTTCA