Description :
From Genome Similarity Track
Location :
Scaffold_3:4568439- 4585380
Transcript NameFunction/comments
Physo_259509HECT ubiquitin ligase, putative
Physo_498211HECT ubiquitin ligase, putative
Physo_287174Hypothetical protein
Physo_560653PREDICTED: poly(U)-specific endoribonuclease-B-like
Physo_314908amino-acid acetyltransferase, putative
Physo_330445conserved unknown protein

Sequence
16941 bases(100 bases per row)
GAGCTGACGTTATGCTGTCGTGAACCCCGTGAGATCGGTGTCCAGCGTAGCGTACAGCATGTTCTTCAACTCCTTCTTGCTGTGATACAGTGGCAAGTCG
AGACGGTTGAAACACGCGTGGCTCGAAATGTACTGCGTCGTCTTGTACGGCACGCCCTTGAGGGTAAACGGGCACAGACGACCGTCGTAGCTGGTGAGGC
CACCAAAACCCGACAGCGGGACGCAGGCAGATCCCGTCGCGAACAGCAGAAGGCGACGGCGGTACTCGTTGGGCATTTGCCGAACAATCTCCCAGAACCA
GCGGGTGACGGTAGCGCCCTCGAGATTGGGAGACAACACGGTGTTACCCTCCCAGTCCGTCACGTCAATCTCGGGGGAGCCACACAGCAGATAGTCGAAC
TCTTCCGCGTCGAACGTCATCAGCATCTCACGCGGGATGACCTCGTACAGACCCTTCAGGAACGCGTACATCTGGTCTGCCACACTCTCGAAGAGCGCGT
ATCGGAAGCGCCGATCCAGATACTCGCGCTTGTTCGCGTCCGTGACGGCCACGTTTCGTCCATTGGGGATCAAGTCCACCACAACCTTCTCGGAATCGTT
CACTTGCTCGATAATACTGAAGTCGAGTCCGAGATCATCCACGCCGTCGTTGTCCATTAACCATCGCAGACTGCGGTAAGTTTCGGGGTCGAGGAACTCC
ATGTCGGCAAAAGTGACCGGCATGCCCAGGATGATCTTCAGCAACGGCAGTGCCAAGTGGAAGCCCCAGATGCCACCTTCAAGCAGAGCTCGACCAATCA
GTCGCCCAGTGGCAAAGTAGTAGGCGAGGTGGTCCTCGCCCACCTCGGCGCGCGACTGCGGGTTGAGGAAGTAGCTCTGGTCGGCCTTGTTCGTGCACTT
GAAGAGCTGAAGCGTCGGCGACGCCAGCATTTCGTTCACTAGCATGAACCATTCGCGGTGCACGCCGCCAGCGTCGACGCCGCTTTCGTCCAGGAAATTG
ATGCGCATGAAGGAGCGCAGGTTCTTGGGCTGGATGCAGTACATGTGGTCCATGGACTCCTCGAGCATGTACTCGCGGTGCACCGAGAGCTTGAGGAACT
CCACCTCCGCAGGCACGATCAACGACGCCGTGCTGACGACGAAATGCGCGTACTTGGATGGGAAGTCGCTCTCGGCCAAGGACACGGCCTCCTTCCTCCT
CTCAGCTCCGGCGTCCGCCAGCGTCGATTTGCCCGTGGCGAACTCGGCCGGATCCGACGCCGACGCCTCCACCAGCTCCAGGTGCACGTCCGTGGGCAGC
ACTGGCTTGGGGTCTTCGGCTGTCTCTTTGTCCTCCTTCGGCTGCTCCACAGCCAGCACCAGCTCTGTGTCTGCCGCCTGCCCTGGCTCCTGCTCTTGCG
CCTCTTCATGCTCACTCGTGCGTTCGTTCTCCTCCTTTTCCTTCTGCTGCTGCTCCTGCTCGGGTTCCTCCTCTTCCGGGAACTTGAAGCGCACCGTATA
TCCAGGCATGAGCGTGTCTGCCTCGCTGCTGGCGGGCAGGTTGCTGCCGCCGCTGCGGTACCAGAAGAGGTTCCCTTCCACGTCCAACTTGCGGCTCCAC
TCCCGGCGGTTCCTGGCGCGCCGCTGCTGGCGACTGAGCGACGACATCTTGCGCGGCCGCGGGGACATGACGAGCGACGAGCGCGCGTCACTCGCCACCA
CGTTCAGGGCGCGCACCGACTCCTGCCGCTCGTTCTCGTCGCTGCTGCCGTCGTCGTCCTCGTCGGCCGTGGCCATGGACAGCGACGGCAGCTTGTCGCC
GCACAGCACGCAGTAGTCGAAGCGCTTGAAGTTCTCGAACTCGCAGCTGGCGCACTGCGTGTAGCCGGCCTCGGCCTCGCGCGTGGCGGCGTCGATGCGG
TGGTCCACCGACTCGCCCGAGAGCAGCGGCACCTCCATGTCCAGCAGGTGGCGGTTGCGCCGGCACGCCATGAGCCACACCACGAAGAAGATGACGCACA
GCAGCAGCATGCCGATGCCCTGGTACAGCATCGACGCCTCGGTCGTGGTCGCGTTCTCGCCGTCCATTGCGCACGTGCACTACAAGCCCGCAGCGAGCGG
GGTCCGGTCCGGTGCGAGGCGATTGAAGACTGTGCACGGCAGCAAGGCAGTCACACGCAGTGTTCCGGGATCCGCCCATCACCGCCTATACAAAAGGCAA
GTCGCGCCCCAGCTGCTGCGGATTCTATCGGATGGGGATTACGCCGATTTTTGGTCACTGGAGCTGGGTAATTATAACGAACTCCCTCGCGATAAAGGCA
ATCCAGCACGAGATTAAAGTGTCGATGTTGGTATCCAAAGGTAGTAGGGACCAGCAGACGAACATTTAGCTCGCGTTAAAGCGACATTTGCCAGATGCCC
AAAGCGCCCCGAAACATTACATGTTCGGGTGGTTTGCTTCGGACCTGCTGCGTGTGGGCCTGTCGGCCCCGTACGTATATGGTGGGCGCTGCATGATTCA
TTTTATGGGCGCTGCTTGTTTCACGCCGCAGCGACCCCGGCCTCAAATTTCGGATCAGCGACTTCAGTTGAACCGGTCCGTGACCTACACTTGCCATCTT
TTGCAAAACGGTCCACGAAGTTTATGACAACGGTCCTTTTTTACCTGCATCTCTGTATGTAGGCACGAATCGATGATGGCAGCACCAAAGTGCTCTCCGT
TTACGCAGTGCGTCAGCAGCTTCAAGTGGAAGTGCTGAATTTTGGCGTGTTGGCCCAGTTGCACCGAAGAGCAGAAATACAGCACCAATGACTCATTGGT
CATTGGCATGCGCAGAGCTCCTGTTCAACAGGAACAGGAACGGCAGACTGCTGTTCCAGGACTCCTTCTGTTCTTACGTTACTGGTACAGTCAGCGAGCT
GAAAAAATATGTCGCTGACATTCGGATAAGCTGTCTAGCCTCGACGAAGCTTTGTAAGACTTCACACGTTTCGCTGTAGTGGGGTGGATATGATGCTGCG
CGATCAAAGTCTTGCGTTGTCGCTCTCGATAAACTTGCCCAGACGCGGAGAATCGATTGTTTTGAGGCGCAAAGCATGTTCATGTGCATCTGGGTGGGTC
GCTGCAGGATGGTGTAATAATAATAATACATTTATCATGCTTGAAGTCTGCGCTGTTGACTACGCCGTCGTGAACCCGTACGTCTCCGTGTTGAGAGTGG
CGTAAAGCACCTCCTTGAGCTCTGCCCGAGTCGACACCAACGGCAGGTCTAGCCTGTTGAAGCACGCGTGGCTTCGGATGTATGAAGAGTGCACGCCCTT
CAACGTGAACGGGCAGATCTGTCCGTCGTGGCTCGTCAGGTGCCGGAAGCCCCCGATCGGTACTCGCGAACACCCCGTCGCAAACTGCAACAACCGACGC
CGACACTCGGGGTTCATATCTCGCACAAGTTCCCAGAACCACCGAAGTACTCGTGTCCCCGTCAGATTCCTGGAGCACCGCGTATGTGTCTCCCAATCCG
TCACGTCGATGGTGTCGCAGCCACATAGCACGTAGTCGAACTCCTCCGCGTCGAAGAGCATCAGGATCTGCCGCGGAATCACTTGGTACAAGCCCTTCAG
AAATACGTACAGCTGGTCCGAAACACTTTCCAGCAAGAAATACCGCAGCCAATGCTCCGCAAACGAGTGTTTGTTGGAGTCTGTGACCGAGATATCTCCT
CCATTTGGCACGAGCTCCACCGTCACCACGTCCCCCTTTGCATCCCGTCTTGTCGCCGTAAAATCTAACCCCAATGCATCCGCGCCATCGTTTTCCAACA
TCCACAGCAGACTCTTGTACGTTATCGGGTCGAAGTCTTCGTAGTCGCGGAAGGTGAGAGGGATACCGAGGATGATCTTCAGCAGTGCAGGTGCAAAGTG
GAAGCCCAAAACTTCACCGTCTAGCAGAGCGCGACCGACGAGACGCCCCACTGCAAAAAAGTAAGCTAAGTGTTCCTCGCCAATCTCCTCTTTAGAGTTT
GTGTTGAAGAAATACGTCTGGGTCTCGCGATTTGTACAAGTAAATACGCCCAACGACGGATCGATCATCAGCTCTGTCACAAGGGTGAACCACTCACGAT
GCACACCGCCAGCATCTACAGCAGTCTCCGATGCAAAATCGATTCGCACCACTGCACGAGTATCGCTGTCATCCATGCAGCAAAAATATTCCATCGATTC
TTCCACCACGTGTTCACGACGCAGGAACAGCTTCATCACTTCCAACTCTGCGGGTACAATCAACGAGGACGTGCAGACCACAAAATGCGCGAATTTCGTC
GGGAAATCCTTTCTCGACAGATCTAGGAACCCCTTGATGTCGACATTCCTCGACGAAGGCGCCCCAGTCGCGAACGCAAGAGCGTTCGCTTCTTCAGCAG
GCACGGTCTGGATCTTCATTAGCCTCGTCTCATTCTGCAGTTTGGCAATGACCCACCCAGGTTCTCCGTCCGATGGCTCTAGAGATACCCCCGTCTCTGC
TGCTTCTTCATAGCCGTCTTCTTCTCTATAGAACACTGGCACGTATCCAGGATACTGGAAGCACTCTTGGGTCGCCTCACGATACCAGAAGACTTCTCCA
CACTTCATTTGCCGCTGCCACTCTGACCGACGTCTGTTACACAGCACCGCCAGTACAATTCAATGTGCAAGTGAGTAAGTGTCCTACCTGCAACGCATAA
CCAAAAACCAACGACCATGAGCCGACCTTGCACGCAGTTGTCGCGCAGTGAGTGGGCCCCTCGCTCGCGCTTTCTCTGTCGGCGAGAGCTTTAGCTTCTC
CCCGCAAATCACGCAGAACCGGAACCGCTGCGTGTTGGCAAAATCGCACACTCGGCAACGCACGACCTCCTCCTCCGCCTCTCTGTGAGGCACACCACAG
CGTCCAGCACACCATCCCAGTCAGCAAGTCTACCCATTGCCTCCACCAGCCCGCTACTTTAATATCCCAAAGTTACGCGTACAGCGTTGCAATGTCGACG
CGGTGCTCTCCGGTCGTATCTCCCCTGCAGTATAAGCCACCGCTCAGTCAGAACCCTCCGCCAGCTCAAGAACCAGGGATTCGCGACCTGCCTGGCGATC
AGCGCCTGCTGCAGCTCGCTGGAGCTGCGCTGGTGATACTTGCGCTGCAGCGCGCGGAACATGAAGCCGATGAGCAGGTAGAGCGTCACCTGCGAGGCCA
CGATGAGCAGCACCAGCAGCTCCGTCATCGCTTCGCTCTCTCTCTCTCTCTCTCTCTTCCGGAGCTTCTCGCTCTCTCGGAGCATAATCAATTTTTTCAA
AGGTCATTCATCTGAACACCTTACATGCTTTAAGAGTCACTATGGCGAGGTAATTTGTATTTCAGGAAAATCATCTCCGGATCGGTACAACATGAGCACC
ACTGCGCTGAGCGACAAGAGCGCGCTGGTGCTGGAGCTGGGCGGGCGCTACGTCCGCTGCGGAATATCCGGGGAGCGCGCCCCTCGCTGCGTGACTCGCT
GGGAGGTGCGTCGTCCTGCTGTCCGTTATGGCCAGTAGTGAGTGCTGATACACAGGCGTCTCTGTCCGTATTCGTAGGTGGGCGACCTGCTGCTCAAGCC
TCTGAGCGCCGCGGACTGGCGCCGGTATCTGTACCCGAAGCTGCACGCCCTGTGCTTTGAGTGAGTTTTGCGTGCGGGTGGGTGGGCTGTCCATTGGTTG
CATTGTCACTGGAGAGCTAACGCTCTTGTGGACAGTCTGCTGCTGGTGAATCCGACGCGCCGGCGCTTCCTGGTGTGCGAAGATCTGCTGCTGCCCCGCG
TGTTCCGGGAGACGCTGCTCAACATCCTCTTCGATGTCATGAAGGTGGGAGTTTGGTTGCACATGGCGTCTTTGATGGTGGCTGACTGAGAGCGCCTGGG
GTTTTAGGCGTCTGCGGTGACGTTGGTGCCGTCGATGCTGGCGGTGCTGTATGCCACGTCCAACCACACGGCGTTGGTGGTGGACTGCGGCTGGAAGGAG
ACGAGATTGCTGCCGGTTTTCAAGGGCATCCCTCTGCCTTATCTCTATGAGAGTAGGTCCCCGTTTTTGGCTTTACTTGCGCTTTGGAGATACTGATAGC
GTCATTGGCTTTGTGGTGTGATAGCTGTTCCTGCTGGAAGTCGGAACTGCTGCGAGTTGATCAAGAAAGAGCTTAATGTCGCTCAAGACCAACCGATGGA
CGGCTCCAAGGTCGAATCGCCAGTGACGGAGGCGGTGGAAGAGGACATCCTTGAACGAGCGTGCTTTGCCCAGCAAAAGGTTGGCCTGATAGAAGTGTAT
TTGTGCAGTGGTGATAGTTGGTTTTACGGGTAACTTGGTATCATCGTAGGATCCACTGCCAAATGTTGTCGACGCCAAGTTCCAAACCCACGACAACAAC
GTTCTGCAGGTCGTTTGACTGCAGAAAAATAATACCTGGGTTGTGCAGAAGGTAATTGTGAAGTTATGTGTTTGCTTGGTCGACAGGTCCCCGGAAGTCT
GCGCACAGGCGCTGTGGAGCAACTGTTACTAGGTATGCTGTGCTTACGTTGCCCTGACGATCTATCAATTAGCTCTAAATGCTTGTTTCCTATGCTCGCG
CAGGCGACGAAAGCACGGATGGAACGTCAATTGTTGACGGCATTGTTCAAGTTTTAAAGAAAACCCCGCTTGACGTTAGGGCCGCCATGCTGGAAAATCT
GCTGTTCGTTGGAGGAACCGCAATGATTCCAGGTATTTAGATTTTGGATATTTTGGAGATGGATCGATGTGCTGACCAATTTATCTTGCTTCGTCTTGCT
TGCCAGGCTTGCCGCAGCGTATTATGGCAGAGGTTCGCGAGTCGCTGCATCACGATAACGAGTTCGCTTCTGCTTCAGTTGCTGTAGACCGCGCACAGCT
TGTTCAGACCTATTTCCCTCGGAATGTGCTAGCGTGGGTTGGAGGTTCCATCTATGCGGCGACCGAAAGCGCGCGGGCATCGGCGATTTCCTCGCAAGAG
TACAGCAGCTCCGGAGGCACCAGCATTCCTGACTGGCTTACTGTTGCTGACGGCGAATTTTGAGGTTGCGTGATAAGCTGAAATACTGGAGGGTGGTTTG
AATGCTGAGTGTATTTCCTACTATCGGAGTTGCCAACTATGAAGGGGTTCGATTTATCAATTCGGTAAGCGGTACGACTTCAAGTGTCAAGATCTTATCG
TTGTGCTTCATTTGCGCGCACTACTGTCGCGCTAGCGGTCAACGGTTTAGTTACTTGCTCGTACGCATTCCCAGTGGTTTCCCGGTGTCGTCCCATGGTG
CCTTCATATTAAGATCAGGCATGCCCTTGAGAGTCGTGGTTGCACCGCTGGGTCGCTTCAATGGAGCTACGTGGTGCGGCAGTGCAGACTTTCGTGGCTG
CATCTCCTTCGCCACCTTTGCATCTGAATCTCCCGGTGACTTGACGTCTTCCTCGCGCCGGTGTTCCTCCTTGGAATCAGCTCGGAACTGGCCCTTGTTA
CGAGAAGTGATGCAGTCGACGGCTGCTGCATCTTCTTCCTCGTCCGCATAGTCGCCTTCAACCTTCCAGAGACTAATGCGTCGCAGTTCTTCACACCCAC
GCACCCCGTTGCGGTAGGTTTTCAGCTGAATGCCCTCTTTCTGAAGAGAAACGTCCGGGAAGTTGGTGTCTAGGAGTGGCTGCTCTTCCTCGCCATTCTC
GAGGTAGACGTAGAACGTGTAGTCGTAATATAGCAGCACAAGCACTACGCCACCTACGTGAATCTTGCTGGCAATGGCCTCCACGTCCTGGATGGTCAAT
GGACAACGTATGAGTGAGTCGCACACTACCTTTTAGCTGATAGTCCACTACGAGCGAGAGCCCACCTGGAATGCAGCGCACTTGTCCATAGCAATCTCGA
AGAAGCACTCGACGTTATCGTCCTCGAGCCAGCTTCCAACGTTCCCTGATCCGTTGACGAAGGACCCGCCAGTGCGCGCCAAGGTTTGCACGAATTGCTC
TGCCTTGGACATTTCCTCCTGCATTGCCGGCACGATTTCGGCTAGATGCTCCATCGACGGGGTGAATAGCGACGTCGCTGGCATCTTGGACACTTCGCAC
ATAAAGGTCTGTCGACACAACAATGCTCAATGAGTGAGGTCGCCGCGAAGATGAAGGGGTCCACGAATCTACTTACCAGGGCATTCTGCTGCCGTCGCAG
CATGGGGATGATGATCGGAATGTCGGACAATTCGAGCTTGGGTCCTAGATCAACGTGGCCATTGTAGCACCAGTTGCCGAATCGGAAGAGAACCTCGCGC
AAACTCGGAGTATTTGTCGACCCTTCAGCGCGTGGAGTACGGTGGATGAGGAAGGTTTGGTTGTAGCCTGCGCCACTGACGTCCTTGCACTGCACCTTCA
GTGGTTTCGGGGGGCTCTGATGCTTTCCGATATTCGCAGCCTGCCACAGCGTGAGCTTCTTCATGTTGCTGCAGTCGTCGTCGCGGTACGTCTGCAAGTG
GATGCCCTGCAAATGGGCGGACAGATCCGGGAAGCGAACATCCAGGAGCGGCTGCTCGCCGTCCGCCGCCTGCAGCACGACGTAGAAGCTTCGTTGGTAG
TAGATCACTAGCAGCACCAGACCGCGCACAAATGTCTTGCTCGCCACGATGTCGATGCCGTCGAAGCACTCGTAGCCGCCGCTCTGCAGCTCGAAGAAGG
TCCGCGAGTTGCTGTCGTCGTCTCCGTCCACCCACGAGTGTTCCTCTGCAGCTTTCATCAGTTTGCGCTCAATGCGCTCGCTCGAGAGCTCAGCGCCGAT
GAAGTCGTACACGTCGTACAGAGTCTCTAGAGGAGTCGAGTACTGGGACGTCGCGGGCATGGCCTTCCACTCGCAGAGGTACTGCAGCGACGCCTGCTGC
TTCTGCAGTGCCGGCACGACCACCGGCAGGTCGGCGAGCTCCAGGTCGGCGCTGCCCAAGTCGACCTTCCCGCTGTAGCACCAATTGCCACAGCGGAAGA
GAACTTCATGCAGGTTGTTCTTGCTGGACCGGACGATGTACGTCTGGTTGTATCCGTGACGGAGCGCCACGACCTCGGGTGTCGGAGCTCCCGACTCGTC
CGCGCTGATGTCGGCCTCGTCGGCCTGCGCCTTGGAAGCGGGCTTGCGCATGGTCTGGCGGTCGTCCTCGCTCTTGGCCTCCATTGTCGCGGCTGGGATC
ACGTCGAGTCTTAAGTGCTTGCTTGCCTCGAAACTGCTCCACTGAGCGCTCACGGACGGAGGGACGCTCCGGATCAAGCCGTACAGCTTCGGTTGTGAAA
CGATCGAGGCGGTCTCCGCTAATTCAGGCGCAATGTCAAAAACGGATAGCGGAGGCGCCACCAGGACAGGGCAAACTCTCGTCGTCTCATGTTAGGCTAC
ATATCTACAGCTTTGCATTGCATTGCAGAGCGACAGCATGCTGAACTATGTGCAAGTGGGTCGCTCTATGCCTACCACTTGTGGGGCTGGGCCCATGCTC
CGGTGGGCTTAGGACCTGCAGGCGCAGCAGCGCTGGGCGTCGGAGCTGCAGGCTTCGTGAGCGGCTTCGCCCACGCGTTTCCGGTGGAATTGGTGGTCTG
CGGGGCTGGAGCGGCGGCACCTCCGGGCGGCGGGCCCCAGGCGGCACCGGGAGGCGGAGGCGGTGCCTGACGACGGACGTGAGGGTTCTGCACACGGGCA
TGGCGACCACGCATAATAGCCTGAATCTTGGTCGCGGCCTGCTGATCCGTCAGCGGCAGCGCCTCCGGGAAGGCCGTGCCGATATTGGCGTCCTTGCCGC
GACCGAAACTGAAGCACTTGATGTTGCACAGGTACGGCCCTAGCTGCACGTGGTTGTTCTCCTGGCCGTTCAGGTAGCACATCGTGTACAGCGCCATCTC
AAACTCGGGGCTCACACCGATCAAGCTGCAGCAAAAAGAAAGTCTTAGTTAGACGCATTCCCTGGATGCCTCCTTGATGATAATTTCATAAGCTGGCGCA
CCTCGTGGACACAGGCTTCATCTCGTCTTCCCACTGGAACTGGAACGTGATGAGCTGCTCCTTGTTGTGCGGCTCCATGAATCTGCAGCCACGCTGCTTG
GGGCGGATATAGCCCCTGTAGTCGATGCGGCCGTTGCGCTCCTCGTTGTAGACCTGCAGCCAGTTGTGGCAGCCGCAGATCTTGCCCTGCTCAGCGATCG
CCGCACAAAACGTAGCAATACATCAGCTAGTGCACGTTGATCCAACCCCCGCAATACAGACCCGTCCTCACATTCTTCTCCTCGCCCACGAACACGTGCT
CGAAGCCCGACGAGTCGTTGCGCACTTCGCGCCGGTAGAGGCCGAACCAGATCTGCTCGAGCTTCTTCTTGAAATCCTGCAGGTCGCCCGAGAACTTTTT
GTTCTTGACCAGCCAACTGCAATTCCACCCAGAACCATTTAGACCATAGAACGCTGCTATTGTTGCAACGAATTGAACGTACGCGTGCGCATAGCGCATG
GGCGCCGTCTCCAGCACAGCGTTCAGGAACGCGTTGTTCTCCGCCAGCTCCTGGGGCGTCACCCGCTCCGTGACTCCGGTCTGCTCAGTCGCACAACCTC
AGCGATTAACACCTTGCAACAAACACGCAATCAATTGCAATGCAACTGTCGGCAGCGCACCTCTCGCTCGTAGTTGTCCAGCAGGTCGAAGAGCAGCTTG
TACGTGCGGCGCTCGAAGACGCTCGGGTCCACGAAGGTGAAGAGCGGCTCGCGCGCCACATCGCCGCGGGTGTACGCGGTCTTGCCCTCCTGCAGGTTCA
GCTCGTAGTGCACGTTGGGCTCCAGCCGGTTGGAGTCGAGCTCCCAGAGCTTGTTACACGCGGCCGAGAGGCTCTTGAGCTCGGCGACTGCAGGCGACAG
CTGGACATCGTCAGCCAGCTACATCTTCTGGCAACAGTGCTGCATTGCGATGAACGTACAGGTCGGGGTGGCGCTGGCCATGCTGCGGGCTTCGGGGCGT
CCTCGGGGGTCGGCAGGCGATCGCGGAATGACAATTGCACGGGTCCGGCAGTATCCATCCCTGCTGTGGTTTACCCACACTGTCGTCAGTTGCTCTGGAG
CGAATGATACAGCTGTTGATTTCCGCCAATCACCGCCCGGAAATCCATCGTGCCACCGGAAACACTGCTGCCACAGCGGTACATTAATGGACCCGACCGG
AGCACATGCGGATCTTCAAAGATACTTTTTCTAGCTGCCCTTGCGTTTTCGGAGTTTTGGCAGCAGCGCAGCAACCGCTTAGCCCTATAAGACTAAGCTG
GTGCGTTCCGATGCATAAGCTTCCGCATAAGCATCAGCGTACGCTGCGTTTTGTTGGGGGCAGGGCAAGCACGCGAAACCCTGCTGCAGACTCTGGCGCC
GAGCCATTGCATTGCGCCAAGAGGCGAGCAAGCGAAGCATGGTGGCGCCAATGTTAGCGCGAGATGAGATGCTGCAGCTGTCGTACTCGGCAGCAAAGCA
ACTCAGATGGATGACCCGCAGGCGTGCCCTACGCTGCCCTGCACTCGCTGTGCTGTGCTGCGCTGCGCTGCCAGCATGGGATGCCACTCGACACCGAAAT
ACAGGATCGAAACGCACCGGCGCCGCATGACGCGCCTAATGGATGGATTTAGCCTGCGATGCTGCCGACATGACATGGAAGGCCGAGTCTTACTGAGGCA
ACGGCACGGTGGAACTGAAGCTGGTTTAACACTGAGCGGCATCCCAGCACGATCGCGCGTTGGACGCCGACCTCGAACGCTCCCCATGGCACCGAATGCG
CTTCCACAACGAACGCGAACTCCCTGTGCCCGACCTTTTGCCTGGATGCCCCGAGACCGAGAGGGGGTATCGCTGCCGCCACGATAAAAAGCCCGCAATG
CTTGCCGCGCGGGGTTTCGCTTGGGCGTCCGTACCTATGTAACGGGCCTTTAACCCTCTGCGATCCCAATAACCTTTGATCCATAATCATCAAATTCGGC
TGTTCCCGTAGTAAACGAATCTTCAAATCAAGTGCCCTTTCAAAATCCATGCACTTCCTGAGCGGCTACGTGACCGAGCTGGCAAAAAAAGGACAAGAGT
GGTTTTGCCTGGGCTTGGCTCCTTGAGCACCGATCGAGTGCGCTCGCAATGATGTGCCGTCGGCGCCACACTCGCACTCGCCTCGCCGCGCGCAGACCGC
TCCCCCCGCCCTGCTGACCAAGCCCCCCGCCAAGCTCCATGTGGGTCCGTCCCGGCGTGCTCAACTCGCGCAGACTGCTCTTCTCGTCCGCCTGCGGCCG
CTCGCGCTCGTCGCTGGGCAGTCTGCGCGTCTTCACGTCCTCCCGCGCGGCGCTGCAGGCGGCGGCAGCGGCGCCCTCCGCCCCCGTCAAGGAGCCCGTC
GGCGGCGGCTACAGCCACGGCCCATCCATGGCGCCGCCCGCCAGCGACAACCACCAGGCCGCGTTCACCGACTTCCTGCCGGCGGTGCCGCCCGAGTGTC
TGCGCGTGCAGCAGGGCGTGCAGACGACGCGCGGCTCGGCGGCCGGCACCGTGGGGCCGTCCTCTTTCACCGCCATGTTCCGGGACATGTCGCCCTACAT
CAACTTCCACCGGGGCACCACCATGGTCATCCATCTGCCCGGCCAGCTCGTCGAGTCCAACCTCTTCGGCGCCGTGATGCACGACATCGCGCTGCTCAAC
ACGTTCGGCATCAAGCTCGTGCTGGTGGCCGGCTCGCGGCCACAGCTCAACCGCCAGCTGGCGCTGCGCAAGCTCTCGCAGCGGTTCGACTGCGGCATGC
GCATCACCGGCCCCATGGAGCTCCAGTGCGCCATGGACGCGGCCGGCTCCGTGCGCTTCCAGATCGAGAGCTACCTGGGCCGGGGCATCGTCAACTCCCC
CGGACGGGCGAGGACCATTAACATCTCGTCGGGCAACTTCATCACCGCGCAGCCGCTCGGAGTGCGCGGCGGCGTGGACTTCAAGAACACGGGCGAGATG
CGGCGACTCAACGTCGAGAAGGTGCGCGCGGCGCTGGACGACGGAGACATCGTGCTCATCTCGAGCATCGGCTACAGCGCCAGCGGCGAGGTCTTCAACT
GCCTCTCGGAGCAGGTGGCCAGCAAGTGCGCGGTGCAGCTCGAGAGCGCCAAGCTCATCTTCATGCACGACGGTGAGGAGCTGGTGGACTCGCGATCCAA
CTCGGTGGTGCAAACCTTCGTGATCGAGCAGGCGCAGCAGTACGTGGAGCTGGCGCGGCAGAACCCGGACATCAGCGGGGACTTCCTGCTGTACTTGAAG
GAGTCCATCAAGGCCTGCGTGAACGGCGTCAAGCGGTCTCACCTCGTCAGTCGACACGTGGACGGCGGTCTGCTGCAGGAGCTCTTCACCCGCGACGGTG
AAGGTCTGATGATCACCAAGCACATGTACGAGGGCATTCGGATGGCCACCACCAACGACATCGTGAGTATCATGCGCCTCATCCAGCCGCTGCTTGATGA
CGACGTGCTCGTGTCGCGCGACCAGGAGCAGATCGAGAGCAATGTGGACACATTCACGGTGGTGGAGCGCGACGGAGCGATCATCGCGTGCTGCACCCTG
CAGCCGTACGAGAACAATTTTGCCGAGATGGGCTGCGTAGCCGTGGACCCGACGTACCGCAACCTCGGCAAGGGCAACGCCATGCTCGGATACATCATGC
GCAAGGCAGCGGCCATGGGCGTGACCAAGCTGTTCGTCATGACGACGCGAACAGCGCATTGGTTCATGGAGCGCGGCTTCGTGGAGGCGACAGTGAACGA
CCTGCCCCCGTCGAAGCTCGCGAAGATCGACCTCAAGCGGAAGTCCAAGGTCTACATCTGCGACATCAGCACCAAGGAGGCTCTGGACGAGAAGGAGATG
CTCCTTGGTATGGAATGAGCCGGTGGTGGTGGTCAACTGCCAATTTTACGCTAGACTGACATTTTGCCTATCGGTCAACTCCGCGATTCCCTTAGAACGG
AGCGAGCAGCCAGTCATATTTAAACTTTACAGCAAGCTGGACAGCACTGACCCTGCTCGGACGATTTCTCTTCTATCGCTTCTCCATGGTGCCTACGCCG
CCAATTATTTCACTGACCTATTTGGCGAGGCTGTCTGATGTTTGGCAAGCGTAACCCGTGTATCCTTGGAAGCAGGAGCACATTCCCGTGCTGTAGTCGC
ACACTCCGCGGTTGGAGCACTCAACGAGGCACAAATTTCCTGCGGCGCCTACGAGGGTGCCACCGGGCACCGTCTTGCCCTGGCAGTTGGTTTCGTCTAC
AGTTGTGCCGGGGTCGTTTCCTGTGGGGCAGTGACCTGTTGAAGTTGAACAAGCCATCGCACAAAGTGAGCACCAGACATCGGACAAGTGCACCGCGCAG
CTCTTTGGACGTACGTTTCGAGCAGTCCGCGCCAAAATACTCGGTGGCCTGCAGCTCGCCGCTCGCCGTCCCGACCGCCCAGCCCGAGTCGCAAACGCAC
CCAAAAATCCTGTCAGCGTCCCATGTGCTGGAGAACTGCAGACGACAGGCGACAATGTTGGCGAACTCTGCTGAATCGTCCGGCCAAGCCGTTGTGCATG
TATGGGCGTACCTGTCCGCCGCCGTAGGTTGTTGGCGGAGAAATGGGCAACGCATTCTTTGCAGCAGCCATCTCGCTCATGCTCAAGCAAGTTCCTTGGT
CGGAGCAGTCGTTGGAGCATCCCACTTCATGAACCAACAGTGTCGAGCATTCTTGTGAGCTACGAGCGACAACCACGCTTGGGTTGATAGATACTGTACG
TACTTCGTTGGCATGCGGCGCCTTCAAACCCGGGGAAACACGAGCAGGTCCCAGAATTGCGGTCACAGACCCCCTTACCAGAGCACTCCACCAAGACGTC
ATGGGCTGTAGTAGCGTCCGTGGGAATGGAGCTCCAAGCATAATCCGATGGGCACACACCTGCATACAGGAAGGGATGTTAGCGATGAAACACTACCAAA
TGAGAATGACGCCTAATGTACGTGTAGAGCAGTCTGGTGACTTGTAGTCGGCGATATCGGTCGGCGCACCCCAGCCAGTGTCGCAAATGCAGACCTTGGA
TAACAGCGTGCAGGTGCCATGGCCACTGCAGTCATTGATGTACGTGCAGCCTTCGCCACCGATGGTCGTGCTCTCCTCGATTGTGTTGCCCCCGGCATCT
TTTGTGCGCACAATGAAGTTCCCAGTCGCCGAGTTGGGAGGAGTCGTGACCTTGTCGAACGTGAAGGAGAGACCAGTGGCTGGGAGGGTATTTGCACCTG
CAATTTTGATCGACACTGAACTTGACGTCGAGGTGCTCAGAGTAGCGCTCGGAATGCCAGCCAGGGAGCTGATGATGACTGGAGCTGCGCCAATACTGTA
ACCTGCAGGGAGAACGGCTTCAATAAAGCCCCCGGCAGGAATTGTGGCAACAGTGTCCAACGTCACAGTAGCTGTCGTAAGCGTGTTGGGGGTCTTCAGT
AATGGACGCACACGGCCGTAACTCAGCGGCTTTTTGACGATTGGAGTGCCCGATACGGTTGTCAGTTGCTCGAACAAGTTCCCGCCGCTATCGGTGATCT
TCACTGTGTAATCCTCCCAGGTGGGGGAGCAGTATTCCACAATGAACTGGTCGCAGGAAGATCCAGGGTTTACGATGGTCTCGAGTGTGAATCCACGGCC
AGTTCCTGGGGCGACTGCGGTGTTACCAGTTGTAACTCGTATCTTGGTTGAGCTCAGCAATACAAATGCGGCGTTTATCGTGGGCAAGTTGACGATGTGG
CTAAATGCCACGCCGCTGATGTCGAAACGTGATGGGAATGTCACTTCGACTCGACTTCCCGACGGGATGTAGGCCGCGTTGGCGAATACGACGTAATAGT
CAGTTGAAATCCCGGCAAAATAGGACACTGGTGTCAGCGACGCTGATGGGAGTGTTGAGCTCGTGTAGGTCAGTCCGGGAATGGCCGTGTTGACCTGGAA
GATGGCTCCTGAAGAGTGGCGCGAGTCAATGCCAAAAACGCCCGTCGTCTGTGCTGCCGGATTGATAATGTTGTCAAATGTGATTGACACCGTCGTCCCT
GCTGCAACGTCTTGTCCGGCAATCGTGAGCTTTACGTACGGGGAAGCCACTTGAACCACAGTAGAAGCCACGTCGATATTCACCATGCTTGACAGAGCCG
CGCCCGAAAAAACAATCTGGCTGTTGCTCAGCGCTGGAAACCTCAGTGCAATCGCGCTACCAACGCGCAAGGTAATATCGGTAGTGAACGTGACGGTGTA
CGTCGTTGTCCTGCCGGCCACCAGTGATGCCGCCGTCACTGCTGCAGTATTCGAGATGGTCCCTGAGGTGAACGTGGATCCGGCTACTGTAGTGGACTCA
ATTGTCATGCCGCTTGAGCTCTTAGTGCGGATCGAGCAGCTCGATGTTGTGCCCTGGCCTGCGGAGCATCTTGTCAGTCGCTGCTACACATTCAAAGCTC
TTTGCAAAGGTCACCTCCACCTGGATTCTGGATCCCATCGAGTGTGAAGGAGATCGCCCCCGGGACAGCGTCCGTATTAACGATCGTGATGGTTGCCTGG
CCGCTTGCAGACGTCGCCAAAACTGTGCTCGCAAGGTCGATACCTCCGATATTGCTGAGTGTTGCGGACGCCACGTAGAAGGTGGAGGGGAAGGTCACCA
CGATCGTTCCTCCGACGGGGATGGTTGTGCCTGTAGTGAACGTCACGTCCACAGTCCCAGTGACGCCAGCAGTGAGAGACGCCGGCGTGACGGATGCCGA
CGAGATCGCTGCATCGATCATCTTCGCACATGACTGCCAGAGAAGCAGTAGCAGCAGTAGTGACCACGGCATCACTCGCGCATCAAACCTTGGTATCCTT
TGCGGCCTTTCAAGATGCAGATGGCTACATAGAAGTTCCAG