Description :
From Genome Similarity Track
Location :
Scaffold_21:45682- 46939
Sequence
1257 bases(100 bases per row)
TTCTTCTCTTTCTGCAGCACAACAGCCACCGCGCTGTCCTCTTTCCCCGTCACTGCTACCTCTTCATCAACGTCCACTGTAACGGCCTTGTCTCCTCCAT
CCTTCACTCGGCCGCCACTCGAGTCATCCACTTGACCAGAGGAAGGAGTGACTCGTTCTTCCCCTCCCTCACGCTCCCGGCATTGACGAGAAGCTTCGGC
CGTCGACGCCTTCAGAGTCGTGGCCAATCCCTTCAGAGTAGCGATCTCGGGACACTGAGAGACACTATGACCGATCTGGTGGCAGTAGAAACACCGCATC
GTCGAGTTTCCTCCTCCGTTTCCACCGCTAGGCGGGCCACGGGCCCCGGTATACGGCATCTCACACTCAGCCACAATATGACCGTAGTGGTTACACCGTC
GGCAAGTCATCGGGTGGCGCGAACACGTCACGCGAGTGTGACCCTTGTAGTCGCATCGGCCACAGACAGGTTCTCCTTCTTGCGTGTGGGAATCCTCCGC
CATCTTGATGCCTCGACGGGCACGATTACCTCCGAACGGACCAGCTCCACCAGCGGGAGGGAGCTGTCCGTGGCCTCCGGAGCTCGGCACCACCGCCGAT
ACAGTAGGCACCGCAGCCGGCGGCACGGACGGCAAATCTTCCATCACCTGGTGTTGCCATTCCTGCTGCTGCAACAGGAAGTCGTCCAGCTTCTGGGTTA
GAGCGTTCACAGTCGCCGTGTGACTATCAGTCCTCGCCCGCGACTCCTCAGGAAATTCGTCGTCTTCCTCCACAGGACGATGCATGTCCTTAAACATTAG
CCACTCGCACACCTCCGGAATATCACAAGCCGGGCTTGAATCTAGAGCAGCCAGCATCCTCTTGTTCTTCAGGCCACGACGGAACAACTGATACCGCATC
TGAGGGTTCGGATAGTCGAGGGAGTCGCACAGATCCGTGGCTCGGTCTCCCCATTCCTCCACAGACTCGCCACGTTCACGCTTAGTGGAGTACAGTCTCT
CCCAGCGCTGGTCAGCTGTCCTGCTGAGGAACCGGTTGTGGAAACGCACCTTCAGCGTCGCGAGCGACTTGATGCTGGAGTTGCTCCACCATCTTTCGGC
CTCACGTCCCTTCAGCTTCTGTCGGAAAACCAACAGTCGCTCTCTGTCTGGCAACCGGTCAGTGTGGTCCTCGAACAGCTCCCAGAAGTCGCGCGCCTTC
TCCACCGTAGCCGTGTCCGAGTAGAACATCGGCAGCACCTTCATCACAGTCGACATC