Description :
From Genome Similarity Track
Location :
Scaffold_473:4568- 10041
Transcript NameFunction/comments
Phyke_g9984conserved hypothetical protein
Phyke_g9985phosphoinositide 3-kinase

Sequence
5473 bases(100 bases per row)
TAAGTGGAAatgattggctaaaatgaTTCGGTTAGTAATACAAAACTCCGACCCACGGTAAGGCGTCTAAGAAGCGTAAGAACGCTGGGGTTCCACAGCC
CAATAGTGGAAAATGTCGGGTGGACGAACGGGATATGCAGATCGAATGCTTCCAAGACGGGTCCATCtttgagctggaagagctcacCGATTGTATCGTG
TAGATAGAGCGAAGAGCGTGCGTTTTTCATAAACACCTGCGGTGTAAACCACATTTCACTCGTGTGGGCTGATGATCGCGCTGCATCTTACTAATGAATG
ACCTTAAACCCAAATAGGCATTAGCCAGGACTCGATTCCAGATCAGCACAAAGTGTTTTATACGTACGCTACAAATCTGAGATCCGATTACCTTAACTAT
CAGTAAAGAGAGCAAGCGAATGATTGAATCTGCTGCtttttttgttgttttttgttttgtttttcacCACCTCACACATGAGGCCGCGACCGCCTCTTTT
CCCtcgtcttgctctttgcGCGTGTCTCCGCTTGCTGTCCACGGTGCGCATTACCATCTTCTTCTTACTCGACCATCGCGTCTAATTTTGCTTCCATCCG
CGCCATCGCGTTCGCCAACTTGTCGATGTCGGCAGTGTGTTGACCTAGTGTGTGGAACATGGCTCCCTGTTGTGTTGctaactgctgctgcgtctccgtG
GTGCGACACAGCAGAtccatcagcatcgtctccatcttggGGCCCGCCGTCACCTGTCCATCTCCCGCGTTCGCGGCCACTAGATCCTGAGACGAAGCGC
CAGCCACAGGCTGCGCCACCACCTGGTTGGCAATTCCAATCCCTGATCCTCGCAGAGGTTCAGCCGCGCGCTGTTGCTTAGGTGCTTCCGCCTCCTCCcc
atccaccacttccacaGCCCCCTCTCCGTTCTCCACGGGGGCCGCCACCGCGTTCTTGCGGTCCTCCAAGTTTTTCATTGCCACATTCGAAAGTTTCTCC
AACGTAGCGATATCACACGTGTTTCTTGGCTGAGTGTCGAACACAAACACCGTGCCCAACAGGTGACCCGACGGGGTGCAGATTGGGGCCCCGGCATAGA
ACCGGATCTTGGCTGCGCCCGTCACAAGCGGATTCTTAGCGAATCTCTTGTCCTGCAATGTGTCCATCACTACCATGGGCTCTTTACTCATGATGGCGTG
AGCACAGAAACTCACGGAGCGCGGCACTTCATTTTGCGCTAAGCCCACACTCGCCTTAAACCACTCGCGGTCCTCATCTAAGAGACTCACGGCGGCAATG
GGACTTTTCAGAGCATTACTGGCCAAGTCGCAAATGATGTCGAAAACATCCTCACTGGGGGTGTCCATGATGTCGAACGTCCTCAAAACCTCAAGACGCT
CAGCCTCACCAGGCACAATTGGAGGTTTAGGCCACGGATGGTCCCAACTAAAGTCCAGCGCGTAATCGAACTCAGCTTGCTGGAAATCACGAGTGAAATG
AGACAAGTCTCCTTCCGAGTTGCCTGTGGGCGAGTGGAAATTCTGCGCTTCCCAgtgttcctgctgctctcgAGGGGGGGGAGAGACCGTGCCAGAAGtg
ggagctgctggcggcgcCTGAGGGTTCGCCTGGCCGTTAGCGTGCGACAAGATGCACGACATACACACACGCACGAGGGATCGACCGATCACAGgcagct
ccgcctccttcttTAAGGTGCAGTTGCCACATaccacttcaccacactgTTGACAGAGATAGATTTTTACCATAAACTTAAGTGAGCAAATGACCTTAAA
GCGACAGAGTTAGATCAAAAGATTGATTTACCTTGCGGCAATGATGCTTTCGTCGGAAGCGCGTGAAGTTCCGCGTGCACACATGACACCTGTATCGCTC
CGTGTCCAGCACCCAGTCGTCCTGGTGGCGCAGCTGGTCGATGGTCAGCACGTCGTTGCCACCGATGGTGCTGCCCTTGAGTCCCTTGCGCGACATACTT
GTGTGCCTGCGGTTGGGTAGGAAAGCTCGACGGTTAGAGAGACCTTTTAGCGAATTTAGAGAACGAAGTTTAGATAAAACCTTACGGTCAGATATAAAGG
GTCTTTTGTGTTCTGCTAAAGGGGGGAGAAGTAGCGTTAAAGACTACAAATCACGGTGGGGCGGGGGCAGCGCGGAAAGCGGGGCTGACTGTGCTCGGCT
TTCGGGTGGGGCTCCGCTgctcgctgtcttcgctGTCCACGCACACTCGGGGGCGCCAAAATGTTGAGTAAGGAGAGGGGGGAGTTTGGGGGGCTAAACT
GGCTGGTCCGAACTGTCTGTTGCCCAAGCCAAAAGAGAGTTCAGGGCTTGGGTGCGCAGAAAGGCCATTCCTCGCCCCCTCGTAAGCTTCGAGGGATCGT
AAAAGGGCCAGAGACAGGCCGCCGCACACTATTCCAGGCGGTACTGTAGAATCTGGCAGCAGAGGACGTCTGGCGGCTTACCGCTCTTATGACGCGGCAA
TAAAAGACCAGCAGAGGCCTCTTGCTGTCGGTGATCGCGCGCGTCTTAGCTGAAACGTCTTGGGCAGCGTGCCCAAACGTCTCGAAATTGCGTTCTTCGG
GTGGGTCATCCCTTTCTTTAGAAAGGCTTCGCAGTGAGTTTGACTAGTTTAGGAGGAGAGGCGACGTCTGCAGTGTGGGACATTCTCAGCGCTCTCGTTT
GATCGTAAAAAGCTCCGCACCCCTTCCCTCGATTTCACTTGGCTTTAGTATGATCGGACGATGACACAACACTTCCAAAATAGTCAAACCTTATCCGAGG
CATTTATTTTGAGGTAATCCGTGAAGAGAACGGGCGGTCCACCTCATCAAACGGCTGAGAAGATTTCAATTGGTGCTTTAGGTCATacacaccaccacca
ccaccaccaccactgtTAGCTATACACGACGCCTTTGATGAGGTTGTGTTCGCCCCTGGTGCATCATGACGGCTCTCCACAGTGTATGCGTCAAAATATG
TGTCAGGAATAGCGTGTAGCAGGTGAGAATAGCGGACCAGCGGCCTGTTTGGAGCGGCACTTCCGCCCTATGATGCTCTTCCTCGACTTCGCGGGAAGCG
TCTATTTGAATGGCTAAGGCACCGCTTTAAAATATACTACGTGTCTTGGAAATCCATCTGCATGTTagatcagcagcagcttggacaGCAACGCATTGAA
AGCGATGTTGTGCACGACAACAGTAGTGCTAGTTCATGTATCGTAGCTAAAACTGATTGTCTTTCGATGACTTCGATCCGCGAGCATTTCGGTGGTGCAC
TGGAAATACAGCGCACCTCAAACAGGTACTTGCACTTGGGACTCGCTGAACTCCATAGCTTTCGACTGAACCAAGAGCAATTTCAGCTGTTATCTAACAA
TAGCCCGATGCTGTCCGCTCAAAGTGACTAACCAAGAGGAGTACTCATTCTGATATTGTTTGAGGCGAGAGCTGTGAAAGCCTCATCGATGAGGCCACAG
AAAAGGACCAGACGGTCATTGCCTCCGGCAACCTGCCGCACCGCCGTGTGCTCAATCTTCAGCAGCCAAGGTCTCGGCAGTATCCTGCACGAACTTGGTG
CCACGAAGCCACACGAGGATCACGTGCGCTTGTCTCCAAAGTGGAATTTGCCAAACGCCGGACAACGCCACAGCGCGCAGAGCCAACAAatttgaagagc
tgcagagcGAACCCCACAGTTGGGGCAGCTCGGAGCTCCGAATGGCGAAATCCGCGGCTCGTTTACTCGATCAGTTGGAAAACGTTCCGCCCTCGCCACG
TTGATGAAGCCAGGCAAGTGTCCAAAGCTGCCGAGCTCCGTCTTCTGTCTATTATGGTTGCTGATAGTTGGTGCGCACAACTTTCTtcctgaagttgaag
tgctttaCTTCAGTTTTCCTTTCAGTTTTACGAAAAACAAGTCATAACATTGCACTAAACACATTATAATGAAAGGTAAGCCGTTGAGCCTGGACGCTGT
TGAGTCAGATGAAACATTATATTGAAGAGGACTGTATATCTCCATCTTGCTTTTTTTCCTTCCCGCCCTGGTGgacctccagctccgtctcgaTGGTTGC
AGCATCGTTGGACGAGGCCGTCTCGATGGCAAAAAAGCAGGTTAATTGCCCCGAAGGCTGAAATGGCTTCGCAGCGGGAATTTTGCTCACAACGTCACGT
CCAGCACACAAGTCACAGATCCCATGTACCAAAACtatggtacactgtaccactTCACTACGGTACACGCGTCGCTTCTTCTAAAAGAAAACTTGCACCA
TGGCGAGCCGCCTGAAGGAGTACCGCTACTACCTAAGCAGCGGCGTGAGCACCGGCATCTCCGTCAAGATCTCGTTGGTGGAGTTGGCGCCTGCGTTAGG
GTGTTCTGTCAGTGGTGATGCACCTAAACGGGCGGCAGCTGCGTCTTTCACAGGCTTAGAGCAACTCGCTGGCACGTCTTCCGAAGTGAGAAATTCACCA
ATTAGTGAGATTTTCCTCACAGCACAAGTTTTTTCTGACGGTTTGCCACTTCACCCCATGGTTATCAGGTAAGAAACATATATCTCCTCTCGCTTTAGAC
ACTTTTTAGttgaaaaagaaaacaaaaaGCAATTTTTTTAACTAACTAATCTTTTACTTAACCTCTCCGTCCTTTAACACAGTTCTAAAAGCCccaccaa
gtgcagcaactccaCTATCTATTGGAACGAGTGGATTTCCTTCCCCGTGAGGTACCGTGATTTGTCCCGCAACTCGTTGCTGGCAATCACCATTTGGGGA
GTTGGCTGGGTGCCTATCGGTGGgtccaccatctcgttcTTCACAAAACACGGCGTGTTGCGTGATGGAGTGCAATGTCTTCGCATCTGGGGAGGCCAAG
AGGCCGACTCTTCGCCTAACACGGCAACTCCCTCAGAAATCAATGACGAATGGGTGCGACAAGAATGTTTCCGACTGGACAAGTTAAGGGAAAAATACGA
ACGGAAGGAAATCCCTCGTAACGAGTGGATGGATAGCGTTACCGACCGCCGTATCGCCCGTATCCGACGTGGCAGTGAACCCCCCACTCGGAAAGATGCA
CTCGGTCCTTTTTGTTCTTATCGCGAAGACGCTCTTCTGTGGCTGGAAATGCCTTACTTTGGAGACGTTGTGGTGTACGAAGAGGAACCCTATTCGCAGC
GCAATCTGACATCTTCGTATACGGCTGACATGGCCCCCAGACGCTTAAACAGTTACGACAGTGGAAGTGCAACGCCAAACCCCCAGTCAGCATACATGGA
TTCTCACACGTTAAGTGGATCTTACGATTTAGCCACAAGTTCCTCCGCGAGTTCCGGCTCCTCGAGAGAATTACCAAGCCTTGTGACAGTGTGGGACCCA
GACCTAAACGAAGACAACCCGGCTGAACGGAAATACCGTCGACTGGCACGCGACATTTTGCGTGGCTCCATTG