Description :
From Genome Similarity Track
Location :
scaffold_850:4568- 5664
Transcript NameFunction/comments
Pl_102137hypothetical protein PHYSODRAFT_543146

Sequence
1096 bases(100 bases per row)
AACTTGCACAGCTATCATCAATCGTCGAGTTGGTAACACCTACCGATGAGTTCGCTTCAGACAGGAGCGACGTAGCTTCGACTTTTCCAGTCTCGTTACC
ACGTGCTACTGTCTCCTGCTGAGTTTGTCGAGTAGAAGCTTCCAACGAAAGTGTCGACAGCGTTGCTGCCACTGCTGAACGACTAGAAGATGACGAACAC
GAAGTCGTTCGCTTCTTGCTGTAGAATTCCGCTATGACAAGAAACTCTGGGCCACCAAGTCGCACCCCAGTGATGCATTTTGCCTGCTGAGAGCAAGTCG
CACAGCACACAACTTCACGACTTGGGTGTTTGGTTCCGGTGAACATCCGCTTGTCTTTGAGTTTGCAATTCTTGCAAATGGGAACTCCACAGACGTCACA
CGAGCGCAAACGCACACCGGACAGCACGCTCTTCTTCTTGCGAATGCACATGGAGCACACATTTTTCTTCGTGAATGCCTTGAACTGCATGCGTTCTTCA
TAGTTTCTATATGCCAACAACGTGAGCTTCTTCGCTTCACCGCAATTCACACTTCGTAGAAGTCCATCTATGACAGACGTCGTAGCGTGTGGTAGCACTA
GTTTGAGCAGTTCCCCACCGGCCAAATCGAAGATTCCTCGCCCCATTACATCTACATAACCCGGAGAGGTTTCCCGAAACAGGAACGAGAAGAACATCTT
GGCACGCAAAACTTTCGTCTTGCGATAGTCGAAGGGTGGACACTCTGGTATGTCCACTGAATGCAAGACCAGATAGCCGTATCGATTCCCTTTTCCATCT
CTTCCAACTCCCGTAGCTTTGAGATAACAAACATCTCTTGGATTGAGGATCGGCATCTTGGTTAGAACCCAGAAAATCTCTGCTGAATGCAACGGGTCTT
CTACTGTTGATCTCTCTACAACATTAAGCAGCACAGCATCTTGAGGAGGTGCAACGAACGACAAACCCGTGATCATCTCCTCCTGCGTCGTACCACTGAG
CCCATAGAGCATGTCTTCTATCGTCCCGTTCACAGATCCATTGGCCAACATGCTTGGATTACCCCGTTCTACTGCTATAGCTGCTTCGGGAAAGTC