Description :
From Genome Similarity Track
Location :
Scaffold_60:45679- 50499
Sequence
4820 bases(100 bases per row)
GATAATAAATAGTGAATCTCCTCCTGTACATCATAGAGGTGGAAATGGCCATGAACTCCGCTATGATCCGGTCGGAACAACATCGAGGTGGGATGGCTAT
CTCAAAACTAGGTGGTCGATCCAGAGAGTAAGATCCCACGTGTAGCACGTCGGTAGACGAAGCTTTCTCCACATGGGATTTGCTAAAACAAAAAATATCC
CGGGTGTTTGCTCCGCCTAATCAGGCATACCGAGTGCGTTCTCTTTTCCTATCTACCCGTCATGGCAAGAAAGAACTATCGGAGTACATCCACGAGCTGA
GAACTCTAATCGCTGCCATGCAGCTTGATCTTCTACCAGAAATGGTTTTGGTTACCATCTTCATGGAGGGCCTTCGTACGGGCGTGGCTCGAACAGAAGT
GTTCCGGGTACACCCCACCTCCTTTGAGGCGGCTCTGGATATCGCGTTGAACGCTGAGTTCAACTTTAAGACAGCCCGTTTTGGCACCCATGGTTACAAA
GCAAACTCGGCGAACTCATTGAACTCATTCAATAGGCCGGAGTCAATGGACTTCAGTCTCGCCGAGACGGACGAAGAAGCAGAACTTCGAGCTATAGAAC
AGCATCAAAACATTCGACGATGTTTCACGTGCGGAAGCTCAAAGCATCTAAGATCTAATTGCCCTCTATGCAAGGCACGCCAGGCTACTTCAGGCCAAAC
TCCCGCCGCTAATCATAAGTCTGGTATGGTGCGGGAAAACGTTAACTCCCAGTAGGAGCGGGAGACCTGCTAGGGAAGAACAAGGTTCTGTTGAGCCGCT
AGGAGGTAGTAACGAGCAGAATTTAGCCCCAAGGAGTCCCGTGCACTCTTACACGGGACGTGAATACAAGCCGGGTTTGTTGGTCGCAAAGGCGACTGTT
AAGGGTATTGACAAACCCTGGTCGATTTTGATCGACTCCGGAGCCGGTACTTATGTCAGACGCGGTTTCCTTGAAGGAAATCCACGTTATGTTGAGGCAC
TAAAACCGCACAAGGGTGATGAGATCACTGTTCGCTTGGCGACAGGAACTCTTGTTACTGCACCCAAAGTTTCTGTAAACTTGGTTGTGAAGGTTTTAGA
CCTTGATAGCGTCTAACGCTGTTTAGTCCTTGACTTGGACTCGAGATATGGTTTCATTCTTGGTATGGCTTGGCTAGAGCTCCATGAGCCATGGATCGAC
TAGAGATCGAAAACATTAGGCGCCACGCGCACTGTCCCTAGCGGATCTTTGGAGAGTCATGAACCCACCTCTGATAGGAATTAGAAGCGCTATTGGCGCG
AGCCAATGGCTGACAATGTCAGTGTGCCGAATTTCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAATATAGAACAAAGCTCAATATG
TGATAGTGAAGCGGCACGTACTCCGCTAAGTGATAGTCGTTGGGAGATCAACGTACTGAACACTGAAAGCATTGTTGAATAAGCGTCAAGTCATCGAGGG
TTGAACCCATCAGATGATCGTGGAGTGGCACGTAAGTACCCACTGGGTGACGTTGGCAGTGATAGCGACGCGCTGAATGTCAATGTTGACATTGTTGGTG
AAATACCAAGGCATCCCGAGCCCGGCTCAGCGGATGTACATGAAGTTGAACGTAATTCACGTGATGACGACGTCATGTCAAATGACTCGTCATCAGATGT
CGATAGTGACGTCAGCTCTAGTTTAGAGCAATATACGGTTGATGATGGTATCGATCAGAGAGATACGAATCACACATCGTGTGCTGTGTCACAAAGTGAT
GATGACTATCAGCTGTATACACTCGTCAACGGAGTGACTGGTGCCTCTGATGGTACAATTAGCCTCGAGGCTATGCCCTCGTTAAGCGCTCTTTCAGAAC
CGAAGAGTTGCCGGTCGATGAGTTTGATCACTCACTTAAGAATGGAGACCTTTCAGAGGTGGTGGTCATTCGACTCGACATTATAAAGTTGAACTCTTCA
TCACTTTCGATGAAGCCGTTCTGGAGGACAAAAAGCGGCACTCAGTGCGCGTATTGGGTCATTAATATTGAAAACCCTCATGACCCCTTTTATCCCTTAG
TCAAGGAATTTTAAGATGTGGTGTGCCACGACCCACCCTCTGTTCTACCTCCAGATAGAGGTGTCCATCATGAAATTACCCTAGTTCCTAAGACTAAATG
CTGTGTCACACGACAGTGGCCCTTGCCTAAGGAGCAATGTGATGTCATTGATGCCTTCTTCCATGCCAAGCATGAGGCAGTAATGGTACGTGAGAGTAAA
TATCCACATGCTACACCGACCTTTTGTGTCAAATAGCCGAACGGCAAGTGGCGTATTGTGCACGTTTACAACAAGCTTAATGCGGCTACGATTCCGGCAC
AGACACCCATTACTCGAAATGATGTTTTTCGAAACAGGATGGTTGGTTGTTCTATGTATAGCGCACTCGACTTGGTTGATATATATTATCAATTGCCCAT
GCGAGTGAGTGATATTCCGCTTACAGCAGTGAGCACCCCGAGTGGTATGCTATGTAAATGGCTGGTGATGCCCTAAGGGTTGTCTAATGCTCCGGCAACA
TTTAATCGTCTGGTGACGCAACTTTCCGCCCACATCGGGAATACACACAGACGTACTTTGATGACATTTTTGTCCGTAGTCGTGCCGAACAAGGTCGGTC
AGATGTTGAAATCACATCGGTCGTTTGCTAGCCGTGCACGAGTGCATGCGTACTAATAAATTGTACGCCAACGCGTCTTAATGCATTTTAGTGCAGAGGA
GATTCCTTTTCTAGGATGTTTCATTGTTAAGAGCGGCCTTAGAGCGGATCCCGCTAAGTTCAAAGCTATAGTGGACTGGCCGATCCCCCAGAATCAAAAA
AAGGACTTGCATATGTGGCTTGGCCTTGCCAATTACTTACACAAATACATTGAAAATACGCTGATATGGATCGGCCATTATCTAAACTCCTTAAAGGAAG
TGGAGTGGTGATGGACTAGCCACAAAGCAGAGAATTTTAAAGCCGTAAAAGAGAGTCTCCTACATGCCCCGACTTTGGCTTTGCCAGATTCTGATCGGCA
TTTCAGTGTCGTCTGTGACGCTTCTGATTTTGCCATTGACTGTGATCTGTTACAAACAGACGCTGGAGGACGCGAGCGTGTCATCGCTTTTGAATCCCGT
CAGCTGAAAGGTGCTGAAAAGAACCATCCAGTTCACGACAAGGAGCTAATTGCGATGAAGTATGCTCTAGTCAAATTCAGATTTTATCTGCTTCGCCCTG
AGCCTTTTGTAGTCTATACCGATCATGCGTCTTTACGCACGGTGACGCAATCGCCTCACCTCTCGCAGAGGATGGCCCGTTGGATTTCATTCTTTGCAGA
ATATAACTTCGAGGTGAAGTATAAGCCGCGAAAGCAAAATACGCTGGCTGATGCACTGTCACGACGGCCCGACTATGAGCTTGCTCACGTCACTACGCTG
TCACTGACCTAATCTGTGCGGCTTATGCCAAGGATGAACAATGTATAGCTTTGCTACGTGCTTTAGGAAGCGATGAGTTTAAAGACTCGGACATTAAATT
GTCGGCACGTTTGCATGCGAGGCTACATAGATATTCAATCGATAAAGGCTTGTTGTGCTATCGCATGGATACTGCGGATACCTCGCGTATCATTGTTCCT
CATGATGATGAACTGAAGTATCGTATCCTCTATGAGGTCCACGACACAGCTATTTGCGGTCATCTCGGTCGTGAGAAGACCTACGGCTTAGTAATCTAGA
ATTATTGGTGGCCCAAAGTCTACAAATGGGTAAGCACTTAGTGCGCACATGTGAGATGTGACAACGGGTCAAACCTCGGCACATGTGACTGCGCCGCTGT
CTAGTTTGCCTATACCCCCTAAGTGTTGGGAGTCCATCAGAATGGACTTTGTGTTTGACATACCGAAGGATTCGGAGGGCAACACAGGTTTTGTGGCCTT
TGTCGACTCTTTGAGCAAAATGACTCACTTAGCGGCTGTGCTGGACTCTATCGATGCAAAGGTACAGCTATGCTGATTATCGATCGTGTGTTTTGTAAAC
ACGGGTTGCCTCAGGCAATCATCTCTGATCGCGACCCTCGCTTTACTGGAAAGCTAGGACTTTCATCTTCACGGTGCGTGGCACGCGATTGAACATGTTC
ACAACGAATCATCCGCAGACCGATGGTCAGACTGAGCGAGATAATCGCGTCATCGACGACGTTCTTCGCAGTGTTCGTGCTGAGTCACCTAAGACTTGGA
GCTCGATGCTCCCTGTCATTGAGTTTGCGTTGAACAACGCTGTTCATGCCTCGACCGGCTTTACTCCGTTCTATGTAAATAGCCTCACGGACCCATGCGT
TCCGCTCACGTTACCACTCCATGGTTCTGGGCTTGGTAAAGGAGAGTCTGCTGAAAAGCTTGCTGATATCATCCCTAACACTATGCACAAACAATTGAGC
GAATTTCCCGCGAAGCGCTCTATTGCCTTACGATATGTGGGTGATACAATGGCTGGAATCTAAGACAAACTTAAGGAACAAGCGGATGCTAAGGGCAGAG
GATGTATTTTTGCTTATGACGTCGGAGACCAAGTCTTTTTAAACGCTAAAAACCTACGTACAAATGTAGTTTCTGCTGTGTAAAAGACGAAATTGCGTCC
GCGCTTCATAGGACCATTAACGGTCGTGGCCAAGAAGGGTCTTGCGTATACTCTCAACTTACCGCGATAATTTCGTACACACCCCGTGGTTTACGTTGGC
CTTTTTAAGACTTATCGGGA