Description :
From Genome Similarity Track
Location :
Scaffold_4:456727- 460979
Sequence
4252 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTTTTGGCTCGCAAATAGTCGTACAACAGACCTCCACATGACAAGTTGAAGGCTGGT
TCCCAAGCTGGGTCTTCGTAGCCTACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGACAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAATTTAATCTGGTTCCCGGCTGTCTCCAGGCAACAGCTCCTCGTTGAAATCGAGTATTGCTTCATTAGTCGCGTCTAGTAC
CAACCGAGTGTTTGGTCGACTGTTGAATTCGTTGATAGCCTTGAGTCTCGACACATGCACCACTGGGTAGAAGCGATACGCAGTTCGGTTTAACAGTTCC
AGATCGTACGCAAACGCCTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCACCGGTGAGCTAATTGCTTCGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAGCCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTTCATCTTTTCCGAAGCTTCTGGGGGGTCCGCCGAGTGTTC
GTTTCCACTTGGCCGAGGTACAGCGGCTTTTTCCAGTCTACTCAGGGCATCATTATGTTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATTTTCG
GCCATAGAGAGGGCGATCTCGTGTTGTCGATTGATTTCGCGCCACCACGCCAGTGCGTCGGACAGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATCG
CCCTCAACGTCGACTGCGCATCCCAACCGTGAGCGATGTAGAACAGTGTTTCCTTCCTTGTAATGTCCTGAGAAGTATTTATAGCTATTACTAGCTTCTC
GGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACGCCCGTACGGAGCCCATCACCGACTTCACCGAGCGTTCCTGCCGTCCATTAGCCTGT
CGTCGATAGCTCAAAGTTGCTCGTGATCTTGACTGCAACATCTCTGCGAACGCTTGAAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCGTTCCTTATCA
ATGATGGGTCTCCGAACCGTCGGTGCACACATTCTTCGAACACTTGAGCAACACTCAGCGCTGTTGTATCCGAAATAGCCTTGGGAATAACGAATCTCGT
GAGCGATCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAGTCCATTGATACGATCAGGAACGGTCGTTCGGCT
AGTTTATTGACAGGCGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCCGGACATGACTTTACATGCTTTTCCACGTCAGCGTACAAGC
CGACCCAATAATAATCGGACTTAACGCGATGGAACGTTTTAACCACACCTTGATGTCCACCTTCCAGCGAGTCGTGACAGCTCTGTAGGACCTCTTTAAT
CACCGTTGTCGGTACAACAAGCCGCAACTTGGTTTCTTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGAT
AACACGAACCGGTCAGCTTACTTCCAGGCATCTCGAGCTTCCTTATAACTAAGCTTATCTGCTTGGCCTTGAAGCACCTTCTTGATGTTAGACCACTTCT
GCTCCTCGTCTTGTGCCACCATTATCCGTCTGCGTCGTTCCCGCTGTATTGCCACCGGGTCAACATCTTCCGCGTCGGGAAATGCTGCTGGTACAGTCTT
GTGAGGATGGTCTGGCAAATCTTCGCCGATTGAATCTTCGTTGGACGTCTCTCGTCGTTCTTCATGCTTTTCTTGAGCTTCTGAGACCCCCTCCGAGTGT
TCGTCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCTAGTCATCACTGCCATATTACCATAATCGCACTCTGGTGAGCTGTAATCAACCACGA
AAAATTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCACGTGACGAAACATCTACCGAGTCTTCATCCGG
CTCGTAGCTCATTTCCTGGATGCGATTCAGCGACGCCAATTCCGACTTGCGAGTTTCAGCTAAGATGACACGACTGATCTTTGATTCCAGCGCTTCAGTG
GCTAACGAATCCGCGGCAGCGCTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGCGAGTTCCTTGTGAGGATTCAGCAGCGCTA
GCAGCGTTTCCTTCCAGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAGCGATAACTAAATCCTCAGCACCGTGCGCAATAGC
GGCCTTGGCACCGTTAATCATTCCTGTGTTCTCTGCCTCATTCACTGTGGTGGCCGAGAGGTAAGCGTTCGCAGCAATCACTATCTTCCACTCAGGAAGG
CTCCAGAACACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGCCTTCGCTGATCCATCAAAAGACATGACGAATCCACTGTAATGACAGGGAAGCC
TGGCGTACAGCAACGCGGGGTCCATCCGAATAGTCGGAGAGCCCTTGTTTGGAGGTACCACCGGCACGAGTGAGTCTTCCAGGTCGACGAAGCTCGTGAT
GCTTGACTGCAGTAGCTGCGCGAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTCAAGTACCACTGCGAGAGAAGCACTGCGAGCTGGACTGCGCGT
CCGAAGAGAGACTTCGACTTATGTACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACCGATCTTCAACA
GCAAAAGTAACGGCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATTTCGGATTACTTAAGCACACGACCGAGGAATCGTACGGGGTGTAACTTGCCTTC
GTGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACATGAACTTCCTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGT
GAAACACTCGCCTTCAGTTTCTCGAAGGAACGACGAGCCACAGAAAGGCCACCTTCAACGGCAAAGTCTTCATCCTTAAGCTGGTACAGCGCCGCATTGT
AGACCGCGAAGTATTGAATGAAGCGGCTGTATTAATTAACCGCTCCAACAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTAATGGC
CGCAAGCTTCTTCGGATCAGCCCTGATACCTTCTGGCGAAATTTTATGTGACAGAAAGTCCACCTTGGGTTGGCAGAATATGCTCTTGGTAAGGCTAATG
CTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAACTCCTCGCCACCGAAGCAAATATCATCCACAAACGATC
GTCGACCAAACACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCCGGGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGCCTC
CACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGTGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTC
GCCGAATATTCAAACCAACCTCTTTTAGGTTGAGCGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGCTCTTAACCCGAAGGG
CATGCGTAACCACTCGAAATGTCCGAGTGCGCTGACAAACGCCGACACTTTACGTGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCAGCATCC
AGCGAGCAGAGCCATAGGTAGCACTCGAGATCGGTCAACAGATCGTCGACTAGTGGCATTGCATACTCCATGATTGCGGTGATAGCATTTACCATCTTGT
AATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATTGGCGATGCTCATGGATTGTCGGAAAAGACGATCCGTCCTGCTCGCAG
CAGAGCGCGCAGCAGCTCGTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCGGTTTATTGGGGCGTGCCCCTGCGTGTCGGTATCGCAGA
CTGCGCCGTAGGCTGGCGGTGGCAGTGCGTTACCACTAGCAATCAAGATGTG