Description :
From Genome Similarity Track
Location :
Scaffold_25:456543- 457931
Sequence
1388 bases(100 bases per row)
TGGTAGTATCGTTCCGACCCGTGTTGAGAACGCGACTACACTCGTCCCACTGCACAACTTTGCCCTTAAAATTCAAAATGAGACCGAGGGCGCTTATAAG
GTCTCGACCAATTACCATTGCGCCGCTGCTATCCTTGATAACCTCAAAGCGATGCGTAACCACCGAGTCAGCCTTTAGTTTCGGGAAAACAAACTGTACC
ATGGTAGTACCGCTGCTAGTGACTGAACCATTCATAGTCTCGAACACGGTTGGTGATGCAGCGATGAGCTTGCGGCCAAGCTGCACATTAGCATCGAGCG
TTGGACCTTTGATGATGCTCTTGGAGGCACCACTGTCAAGTAGCACCTCGAACGTTGGTCCGCCGCGACTCAGCTTCACAAGAACGCGCAAGGAAGCTCT
CTACGGTCGTGTCTTCTTTTCCACGAGGCCGACGAAGTTGATTTCGTCTTCCCCGCTGCATGAATCTGAGTCTGAGTCTGAATCAGCTGCGAAGTCGTTG
TGAATGCGGGGATACCGCTTCTTCTTCGTGCGGCTCAAATTGTGTTCGTCCTTCTCCCTCCTCTTCAGGGTGTGACAGTCGCTGGTACTATGCAAGGCTG
TCTTGAGGAACGTACAACACGTACCATTCTTGGGTCTGGCGTCATCGCCACTACCGTGCTTCATACTGTTCTTGGAACGGCGCTTTGTCGAATAGTGACC
AGTGTTCTTCTCACCACGATGGTCCTTGTCTCTTGCATTACTGTTGCTCCCACGATTCTTGTGGCGTGGTGACTGCTGTCGCTTGGCCTTCTCGAGGCGC
GAGAAGTACTGTACAAGCTCACTAAAAGTGTCGTAAACAACACCCGCCGACGACAACTTGTCCTGCCATGCACGCGGTATCCCGCGCTTCAAATATCTGC
ACTGCTGCACCTCGAGCACCTCCTCGGCGTCCAGTGGCAGTTCGGCGAACATGCGGACGTTCTCTTTCAGACGCTGGGAGAGCTTCAGCACGTGCTCGTC
ACGCCGTTTCGTCATTGTCCACAGCTCGTTGTCCAGGTCCTCACTGTAGTCGTGCGGGACCATCAGCAGCCCCACATCCGTAAAGAATTCCTGGAAAGTA
TTCGCCTCGTCGGATGCAACTTGAGCGGCTACTGTGAATTCAGCTTCGATGTCTCCCTCGACGAGCGCGACGAGGTTGTGAGCCTTCTGCTGGTCCGTCC
ATTGCTTCTTGCGGGCCAGGCTCTGGAATTGTGCGCTCCACTTAAGCCAGTCACGCGGACTGCCACCACATCACTTCTTGATTTTAACTGTAGCCGTCTC
TGCAGCCGTGCTAGCAGTTGCCGCGGTTACCACTAGTTGGTACGATACGTACTTGTCCTTGTCGTTGCGTCCCATGCTTATTGAAATT