Description :
From Genome Similarity Track
Location :
Scaffold_97:45648- 49653
Transcript NameFunction/comments
Phyra_83809PREDICTED: tyrosine--tRNA ligase, cytoplasmic
Phyra_83810predicted protein
Phyra_72160protein arginine N-methyltransferase, putative

Sequence
4005 bases(100 bases per row)
AAGGTTGTGGTGCTCTGCAACCTCAAGATGGTCAAGGTCGTGCGCACGCGCTCCACGGGCGGCATCCTGTTGTGCGCCAACGACAAGGGCAAGGTGGAGC
TGCTGGACCCGAGTCCGGAGGCTGAGATCGGCGAGCGCGTGTACGCTAGCGGCGAGGAGGTGCAAGAGCCCGTGACCCCCATCCAGATGAAGAAGAACAA
GGTGTGGGAGACGATCGTCAAGGGCATCAAGACCAACAACAAGTGCGAGGTCGTGTACATGGACCGGTACCCTGTGCGTTCACGAGCGGGCCCCGTTCGC
GTCGAGACGCTCAAGAAGATCGCTGTAACCAAGTAGGCGCGGCGACAGGCTCGTGTGTCCCCGTGTAGTAGTGTGTGCGTTAGAAAGCTGGGCCAAAACG
ACCGCAGCGTGGAAGCGAGCTGAGTTCGGGAAGCAACCGCAGACGACGTGGCGGGTCCTCGTGACCTGCACGAGAAAAAGAATAAATACAAAATATATCT
ACGAGTTGCTTGTGATCAGGGGGAGGAGAAGCGTCGTGTAGCCGCTCACAGGACTGTAGCGAGGCTGGAGGGCTGGGCCTGACTGATTTGTTCGCTGCAG
CTTTGGTGTTGTGCAGGTCTCTGGTGAAGGATACCAATTGACCTGGAAGGCCGCGTTTTTGATGCAAGATCGGTCTTAAACAGATTGGTGGATTGTCATC
CAGTATCCAGCGCTGTCTTTTGGCTCGAATTCACCGTGGCCTCCAGCTCTGCACGAAACAGCTTAATGAAACGTGTAGTCTTGGATGTGTAGTATTATTG
TTGGCGACGTGCGTAGCGCTCTCAACACCACTACCTCTCTGTCTTTTCTTCTTTGCGTATCTCGCTCACGAGTCGCCCGCGAACGTGCCGTCGTCGCCGC
CATCTCCGCCGAAATCGCCACCAAAATCGCCACCGCCAGTATCTCCGCTGAAGGTGTATGTGTTGTCCGACATGCCACCCGTGTCGCCGCTGTTGTTGCG
GCCACCGAACATGGAGCCCAGCGCCGCGCCGGCGCCCAGTCCTCCCAGCGCCCCCAGCGCTCCTGCTGCTAACGAGTTGCCACCGCCGCCGCTCTCGCGG
TACGGAGACGACTCGTACGCTACGGGTGCCGACGCATAAGCGTAAGGAGCCTGCGATTGCTGTCCCGGGTACGTGCCGTACTGGCTGGTTGCGACGGGCT
GCGCGTACGCGAACTGTTCGTCTCTCGCTTGCTGTGCGCGACGTGCCGGTAGGTAGCAGCAGCACACGCAGCATGTCAGCAGCAGCGCGAAGAAGACGAA
GGTGCTCGAGATGCCGCTCGAGTGCGAGCTCGGGTGGTAGTCGTCGCCGCCGTAGTGAGCTGTGGGCACCACACGGCGGCAGCGGCACTCGTACGGACTG
GCGGCGCACTGCGCGTCTCGCGGGCAGCAGCACGGCGCACCCGACGCCATGCCGATGCAGAACTGGCCTGGTTGGCCGCGGAATGCGTGGTCGCACTGGC
CTGTTTGCTGACACAGGCCGCAGCCCGAGAAGGCGGCGGACAGCGTCGCGTTCTCCACGAACTCGTGGAACTGCTGGCCAGACCGCAGCAAAGCGTCGGT
GGGGGGAAGCTCGGCGCACACGCCCAGCGCCGAGAACAACAGCAGCGCGAGCCACGTTAGTCGCTGCATGACTTGGATAGACCTGATTCGATGTGGCTCC
GCTTTTTGGTCGAGAGGTTTATGACGGGATACAGAGCCTCTCCTTTTGCATAATATCACCTGTCGTATCGCCTAATCTATCAACCAGCCATAAACAACGG
TTTTTGCCAAAATGAGCCGCATCTTCGTGGGGCTCGAGACGTCCTTCGTCCACGACCTGCCGGCGACGCTGGACAAGGTTTGACCCGTCTCTATTGACTG
TTACTGTAGAGTGCTCATTGTGCTATGGATTGCACTGGCTTCAGGTCTATGAGGACAAGATGAATGGCGTGGCGGCGCCGCTTTTCCACCCTCGGTACAT
GTGGATACCGCACGAATATTCTTCGCTTTTCAACCGCTAACACTCCAAATTGATCTGCAGCTTTAAACGTGACGATCGACAGGTGTCCGATGCACGGGAT
GGTCCTCAATCGCGCTCGGACCTGGTCCTGGACTCGCGCGGCTGGACGGCGTCCGTGGTGGGCACCGTCTCCAAGTGGATGGACCTGGACGCGGCCACGC
TGGACGGGCGACTGGGCGCCGAAAAGGTCTTCAAGCAGGAAGTGGCCTGGGCCTCGCACCTATCCGTGCCAGCCGTGATGCTTCCTGCGCCGCGACACGC
ACACTCGAGTGCCAACTACTCGCGCGTGCTCAACCAGTCGCTCACCCAGGCGCAGTATCTTCAGTTTTGGGTGCGTATCCCACTGACGCCAAAGCAGCAG
TCGAGTGCCAAAGCACCTATGGAAGTGGATGCGGTGGCGGGGCTGCGGGGCGCTGCTATGATGGAAACAGATGAGGACGAGGACGAAACGCTGACAGATC
CGTGGGAAGCCTGGGACGCGTTGCGTGCTCGATGCGAGTACCACCCGAAGCTGCATGTTGCGCTGGAGATTACAGCGGACCTGCCTACTGCCGAGGAGAT
CCAGCGCTGGCTGGGCGAGCCTGTCAAGGTGAGTGATTAGTGCGTTGCTTGCAGGCTTACATGGCTGACCCAAATGGTGTGCTCGGGATGCAGGCTGCGA
TCATTCCGACGGATATTTTCCTGACGAACCGTAAGGGCTACCCGGCACTGTCGCAGCGACATCAAACACTTATGGCGCAGCTTTTCCAACATAACATCCA
GTTCTACCTTAGCGGGCGACCCCGTCATCGTGGGAAGCTTCTGCCGTATGTGCAGTATTTGCACTTCCTCTATAGCAAGCGTCCGAGCCAGGACCGCAAG
GCACAGTTCGAGGCCCCGTACCTGGACTATCTCCAAGCTCCGCTGCAGCCCCTGATGGACAACCTGGAGTCGCAGACTTACGAGACTTTCGAGCAGGACG
CCTTCAAGTACAACCAATACGAAAAGGCTATCACTCAGGCACTTGAACAGACCCCTGAAGACAAGGAATCAGTCGTGATGGTTGTTGGTGCGGGCCGCGG
ACCGCTTGTACGTTGTGCCCTTCGCGCTGCTACTGTCGCAAACCGTAAGACGCGTATGTTCGCCGTGGAGAAGAACCCGAACGCCGTCATTACACTGCGC
AATCTCAAAATCTCGGAGAAATGGGACAACGTGACAATCGTGGCGTCGGACATGCGCAACTGGCACACAAAGGAGCGCGCGGACATCATGGTGAGCGAGC
TTCTGGGGTCTTTCGGCGACAATGAACTGTCTCCGGAGTGTCTGGATGGCGCACAAGACTTCTTACACGGTAGGTACTTGCGTCCTCCGATGCATGGCTA
CAAGAAACTGACTGTGTTGTTTTGCAGAGAATGGCATCAGCATCCCTCGCGAATACACTTCGTTCGTAGCGCCTGTGATGTCGTCAAAGCTCTGGAACGA
GGTGAAGGTGCATGATTCGCTAAAGAGCTTCGAGACCCCCTACGTTGTGCGCCTACACAATTTCTATGCGTTGGCACGTACGCAGCACTGTTTCAAGTTC
ACTCATCCCAAATTCAACACACGGATCGACAACAGGAGGCAAGCAGAGCTACGCTTTACCGCTGCTGAGAGCGCTACCGTTCATGGTCTGGCGGGCTACT
TCGATGCCGTGCTGTTCGGGGAGGTGACACTAAGCATTGAGCCGGACACGCACTCGGATGGTATGTTCAGTTGGTTCCCCATTTTCTTCCCCCTGCGTCA
ACCACTGCGCTTTCAGAAGGGCGAGGAGGTCGTGGTGAACTTCTGGAGACTCGAGTCGAACAACCGGGTTTGGTACGAATGGTCTGCGTCTTCGGGTGAT
GGTAAGTGCCACGTGCCAATCCATAACCCCAACGGGCGATCCTACTGGATTGGACTGTAGGAGGGACTCCAAGCCAAAGAGAGCGACAATTCGGATCACC
GTCAT