Description :
From Genome Similarity Track
Location :
Scaffold_23:456406- 460955
Sequence
4549 bases(100 bases per row)
ACTTCCTCTAGCTCAAGGTGCTGTGTGACCCCGTCACACTTAGTAGCAAACGTAGTCAATCCACGCCAACGCGGGTCGACGAGCTGAACCTCTCTGAAGT
TCGTTGCCATGGATAGGAATGACTTCTCTCATCTGAACGACTTGCAGTTCGAGTCGGTTCGGAAGATGCCAGGCATCTTCGGGATGGAGGCCCTGCTGAG
TCTGGTGGCGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTTGACGCTTACGTATAGGGGCTCATCGCGCATGTGCGGGAGAACCTGCAGGGT
CCGGCGGCGGAAACAAATCCGCCACACCCGAAGCCAATACGGCTGAAGGTTAGGCCGTATGAAGAGAAGGAAGGTGAGAACCTTCACGTCTGGGTCCGAG
AGGCAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGGGTTGGGTGTA
CACACGGGAGGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTATGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCTCGTACAAACAAGGGAGACGTGAACTGCACGAGTACGTCCAAGAGATACGGGAGATCACGGCGTCCGTAGTGGGAAACCCACTCA
GCGAACACATCAAGGTGACTGTGTTCATGGATGACCTTCGAGTGGGCCCCGCAAGCACTCAGCTGTTCCGGGTGCAGTCAAACCCCTTGAAGAGGCGATT
CAAGTGGCTATTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCGCAGCGTGGCCTGGGAGTTCCTTGTCGACCCCCGGTCAAACGAGCCCCA
ACGGACCAGTTCCCATGGAATTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGCTGGGCCACTTCAAGCGCGACTGTCCCGCGAA
AAGCCTCCGTAGACGGACCTTCCTCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAAGATCCCGGAGACAGGGGAACGGCGGGAACCAGTAGGGACGG
GGCGCCCTACTGGGGAACAACTAAGTCTTCGTGAAGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAACCCCTGAGAGTCTTCGCACTCTCAAATCGGC
GAAGAGCAGCGGCGAATTGCTCGTAGTGCACGGATGTGTACGGGGATACGATCACCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCA
CGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGTTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGG
TCGTCACTGTCCCCAACGTCCAAGTGGATCTGACCGTCAAGTTTGAAAACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCAAATGATAT
GATCCTAGGCATGCCCTGGCTTGAGGAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGGCAGCCGCCCTGTGCAGTCCGACAGAGCATTG
ATGATTCATGTTCCCACCTCTGTCAGGGCCAGGGCGCCCGCAAGGGTTGCCAGGGTACCGAAGAATCCAGCTGATGCCTGGGAGCCGTCGACGTATATGA
CGACTCCGAGGACGCTTCGATGGCGGCGGCGCCCAGAGGAGGCGCTGGCCAAGTGGGTAGCTTGGATCCACAAGCGGGTAACATAGTTCCGCAGACAGCT
GCAGCTGTCACGAACGCTGGTAATAGCGTGTTCAAGGTGGGTAACATAGTGCCACACGCGATCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGTATACA
CTTCCTGTGTGGGTTACATAGTGCCACACGCAGTCGCCCAGACCTTAACCAAAGCGGAAGCCGTCGGACACTCTTCCTGTGTGGGTAATACAGTACCACA
CGAATCCTCAAGTGCCTCGGATGTCGGTGCTCCGACATCCCCAGACGTGGATAACTAAGCTCCACGTCACGGTCGCCGTCGACGACGACGACGTCGCTTC
AAGCGACTCGAAGTCCAGGGCCCGGGCTCCTCCGACACGGCCGGTGGAAGTGTGTTATCACATCTTCGATGGCGGGACCGGTTTATCCGTCAAGGCATCT
GGTGTCCATTTGGAACCGTTGCCAGAGGTTGCCGAGATACTGAACCTTGAGGAAATGATGGTCGAGGCTTTCCTGGTCAACCTCAAGGCTGGAAAAGGTT
GCCGAGATGGTGCTCATAAGACCTGAGACCACTCGGGAGGAGCTGAGCGCCTCCTCTGTCTTGAACGAGGACGTCATGGAGGACCTAAACAAGCAGCATC
AGACGCGCTTGGGTTCCGAGATCCTTAATAACCCCAAGGATCCGGTGTGTCCTTTGGTGACGGAGTATGCGGACGGGGTGAACAAACACCCACCGACCCA
GCTCCCACCAGATCGAGGCGTACGGCATGAGATCGATCTCGTGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGAG
GTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCCCTCGACGCCAACTTTCTGCGTTCGGAAGCCGAACG
GAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAACGCGACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGCTGTTGAACAACATGGC
CGGTAGCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAGC
GGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGTGACGTTCAACCACCTGGTGACGCAATTGCTCCGCCCTTTGCGTACCT
TCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCCATGGAGGTGCATCTGGGGTACCCCCGTCGAGTGCTGGA
CGTAATGCGAGCGAACAAGTTCTACGCCAACATCGACAAGTGCGTCTTCGCGTCACCAGAGATTAAGGGTCTCAGTTGCTTCGTAAGCAACGTGGGCGTT
CGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACA
AGTACAGTGCAGGGTACGCGGGCTTCGCTGAGCCCTTGTCGGGCCTCCTTCACAAGGACGCCGACTGGCGCTGGGAGCAGGAGCACGAGGATGCCTTTGA
TAGAATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGCCATCGGT
TGTGCACTGCTGCAGGCCGACACGGCTGGACATGTACGAGTTATATCGTTCCAGTCCAGGCAGCTCAAATCCGGCGGAACAGAACTACCCTGTCCACGAC
AAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGCTCACCTTCTGGGCTCCCGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGA
CGGCGACTAACTCGCCTCACCTCTCCCAAAAGATGATGACGTGGCTGTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAA
CGTGCTTAGGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGG
GACGATGAGGCTGTCGCGCCTATCGTCAAGTTCTTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGAT
ATGAGCTGAAGGATGGCCTCCTCTATTACCGGGTGGGGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACAAGGATCTGAAGTTCGACATTCTCGC
GGAGGCGCACGACGCGCCCTCCAGCGGCCACTTAGGCCGCGAGAAGACCTTTCTGTCGGTATCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTC
GCCCGATACATGAAGACATATGAAACATGTCAGCGGGTTTAACCCGCAAGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGA
AGTTGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGACGGACACGGAAACACCAAAATTTTTGTGTTCGTGTGTCGGCTGAGCAAGATGGGACATCT
TGTTCCGGTCCCCGTCACTGTTACGGGCGAATAAACCGCAAGGTTTTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGAC
CGAGACCCGCGGTTCACGGCTGCTTTTTGGAAAACGCTGTTTCCTTTAC