Description :
From Genome Similarity Track
Location :
contig_61:45638- 47305
Transcript NameFunction/comments
g9183.t1mannosyl-oligosaccharide alpha-1,2-mannosidase, putative

Sequence
1667 bases(100 bases per row)
CCACGTCTTCGCATGTACATTTTCTGATGGAGTATGTACCTGGCGGAGAGCTCTTCCACCGACTGCACACTGTCGGTCGGCTATCCAACGACGAGGCCAA
GTTTTACGCCACGGAGCTCATCATATTCATTGAGGGTTGTCACGAGAATGGCTACATGTATCGCGACTTGAAGCCCGAAAACGTTTTGCTGGATGCTGGT
GGGCACATTAAGGTCGTGGATTTCGGATTTGTCAAGCGGCTTCGTGGACCAAGCGATCGCACCTCGTCAAGCGTCGGAACGCCTCAGTATTTGGCGCCGG
AGCAGCTCACGCTGTCTCACCAAGCGCGAAACTACTCGCGCGTCGTGGACTGGTGGGCGTTTGCGTGCGTGGTGTACGAAATGGTCAGCGGTTCCCCGCC
GTTCACGACGCGCCGCAACGGCTCGCACTTTGAGCTCTACACTCGCATCCTCTCGGGCAAGATCTATTGGCCGCGGTACATGCAGAGCTCGTTGAAGGAC
TTGCTGCGGCAAATGTTGCAGCCCGACCCAGCCAAGCGACTGAGCGACGCAGCGGATATCAAGAAGCACGTGTGGTTTGAAAACGTAGACTGGGACGTCG
TCCCGCTCCGACAAGTGGCTGCGCCGTACGTCCCGAGACTGGCCTGTGCAGGCGACACGACCAACTTCGACGAGTACCCGAGCTCATGCGAGGAGACCCC
ACCGCTCGATAACGACCCCTCTCGACAAGAGTTCCGCAACTTCTGACACGCAGCCCGCTACGACGGACATCCAAATCGCCACAACAATCACGCCAAGGTG
GCAATCATGGCGAGGGAGTCCAACGAGCCAGACGTGCTTCACCGATTACCAGACGCTCAATAATTCGTCCTGGTACGGAGCGGCAGATGGCACCGCAGCG
TCGTGAACGTTTTACGGTGAAAGTGCTGCATACGCGTCACATGGCGACCGTATGAACTCGACGAACAGAAGCAGCTCCTGCCACTTTGCGCCGTCTGCAG
AACACTTCAACAAGGGCGATACAGCGCGCTCATGGATTTTCAAACGGCTGCAACATACGATCGTTCACTGCAGCTTGGTACGATGAGAGTCGGGGCTGCC
AGCACTTCTATCACCCCCTACTGTTTCCAAGCAAGCGGTATGGATGGCCACCTCGGTATTCAAACACTCGACGCAATCTACCGGAGCAGCGGGATCTGTA
GACAACCAGCAGTGGAGCAACGACAGATATTATACATACCAGCAGCGAAAACTCAATAAAGTCGACTTCCATGGTGGCCGAAATGGCTGGGGAAAGGCGA
GACAGGGTTTGTTTCGGCTGTCCTTCTCCGCTGTTTCGGTTTCACTATAGCTGCTCGCATCGTGAGTGCTTTGCCGCCACCTCGGGCCTCTTCACTCGAG
AATCGAGACTGGAGCGTTCACGTCCACGGTGATTCGTGGCCCGAGCGTCCGAGGAGAAGCCGAGAAGAAGTGCAGGAGCTGCAGCGTGCAGAGACCGGCA
GCGAGCGATACAAAGCCACAAGCGGCTTACTCAGCGCGTCAAACATGGCCAAAGACAACCACAGTCCGTCCCTGGACCCGCTGCACTCTCCAGGAAGCGA
CACACCGCAGCAGCAACAGTCTCCGGTACGCAGCACCTGGAGCAGAGCACAAGACGCCGCCAAACAG