Description :
From Genome Similarity Track
Location :
Scaffold_72:45636- 47653
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_21053Hypothetical protein

Sequence
2017 bases(100 bases per row)
GGGCGTCGAAGACATGTGCTCGCTCAACCATTTGCACGAGGCCGCGATCGTTTTAACCTCCGCACGCGCTTTGCGCAGCAGTGCCCGTACACGTACACGG
GCAGCATCGTCGTCGCCATCAACCCATATGCGTGGCTCAACCTCTACTCGAAGGAGACGCAGCGGCTGTACGCTGGCGACCGGTCGGGCCTCCCGCCGCA
CGTTTACGCGACGAGCGCCGCGGCGTTCGAATCGATGGCCCTCTACGACCGCCCGCAGAGTACGCGCATCATCATCATTCCACGTGCTCACTCGGTTGCT
ACATGCTCTAGGTATCCTCGTCAGCGGCGAGTCGGGTGCTGGCAAGACCGAGACCGTCAAGATCATGATGGAGCACATTGCGAGTCTGAGCACCGACCCC
AACATGAGCATCATCGACAAGGTCCTCAAGTCCAACCCGCTCCTCGAAGCCTTTGGCAACGCCAAGACCGTTCGGAACGACAACTCGAGTCGGTTTGGCA
AGTTTACGCAGCTGCAGTTTGACGCGGACCAGCGCATGGTCGGCGCCAAGTGCAGGCACTACCTCCTCGAGAAGTCCCGCGTCATCTATCAAGCCGCGTC
CGAGCGTAATTACCACATCTTTTACCAGCTCAAGGCGTCAAAGGAGCCCGAGTGGGCGCTCTCGGAGACGACGTTTACCTACCTTCGCGACGACGCGCCG
CCGCTGCTTCTAGACGGCGAGACAGACGCCGCACGGTACCAGACGACCCGAGATGCGCTCTCCACGATCGGCGTCTCGGTCGACGAGCAAATGGCGCTCC
TGAATGCGCTCGCCGGCATCCTGCACCTGGGGCAAGTGGCGTTTGCGTCCAAGGCCGAGAACGCCGAAGAGTGCGCGCCGATCACGGCGTCGCCGCATTG
GGCGCACGCGTGCCGCCTCCTTGGGTTCCAAGCCGACCCGACGGCCCTCGGCAGCGCGCTCTGCAGCCGGACCGTCAAGGCGCGCATGGAGGTGTACGTC
GTCCCGTTGACGATCGACCAAGCGACGGCGAACCGCGATGCGCTCGCGAAAGAAGTGTACGCGCGCCTCTTCAAGCACCTCGTCCAGCGCGTCAACGAGA
GCATCTCGAACGACGACGCGACGGTCGGGCACATGGATCTGCTCGATATCTTTGGCTTTGAAGCGTTCGAGACCAACCGGTTTGAACAGTTTTGTATCAA
CTTTGCCAACGAAAAGCTGCAGCAAAAGTTTACGCACGACGTCTTCAAGAGCGTCCAGGACGTACGTCGCTACTTGATACATTGATAGTGCGAGCAGAAA
CATGGGTAGGAGTACACGCGCGAAGGCCTCGGGTGGACGTACGTGAGCTTCCGCGACAACCAAGACATGCTCGACATGCTCGAAGCGCCTCTTGGCGTCA
TCTCGCTGCTCAACGAAGAGTGCATTCGACCCATGGGCAACGACCTCGCGTTCTGCTCCAAAGTGCTCTCGAGTCACGACGCCAACCCACGTTTGGACAA
GCAGCGCGCGCGGGTATCAATCTATCAATTCATCAATGCATCAAGCTATCAAGCGAGGTAGTTGAGTTCGGCACACTTTGCCTTGCGGCACTATGCAGGC
ACGGTCATGTACAACGTGGAAGCGTTCGTCGACACAAACAAGGACGCGCTCTCGTCCGACGTCGTTGCGCTCCTTGGCGCGAGTGGCAATCGCATCCTCA
CGAGTGTCTTTGAGCCGTCGCCGAGCAAGAAACCGAGTGGCCTTGGCGGCCGTCGCATGTCGACTGCGTCGTTTATGGGTATCCTGGATACCTGGATAAT
ACGCAATCATTTGAATGACGGGATTTTAGGCGAGACGGTCATTTCCAAGTTCAAGGCGCAGCTCACGGGCCTCATGGCCGACATTAGCGATACGCAGACG
CACTACATTCGGTGCATCAAGCCCAACAGTGCGAAATCGAGCACGCTCTTTGATGTGCATGGCGTCATTGAGCAGCTGCGCTGCGCCGGCGTCGTCGAAG
CCATTCGCATTTCGCGC