Description :
From Genome Similarity Track
Location :
Scaffold_25:4563- 7555
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_25-snap-gene-0.39Ribosomal RNA large subunit methyltransferase N
Pytul_var.sporangiiferummaker-pug3_contig_25-snap-gene-0.26Transcription factor jumonji (ISS)

Sequence
2992 bases(100 bases per row)
NNCGTGCGCTTCTTTACCATGTTGCTCTCCTTTCTCAAGCTACAGTATTGCTAGTTTAACAGGGCAACATGAGCGGACTGAAGCCAACCATCCATCAGCG
ATCGGTACATTGTACCGCTTCAACTGGTACCATTCGCCACTAGCTCGTGTTTAATGTAGACTACATACAACAAGGCCCAGTGAGCGCAATGCGTAGTGTG
ATTGGCTATATATGGACCATTTTTCGTCGAATCACGGCCATAATTATGGTGCTGCTCCAAGGCGAGCAACACACCGCCATCTTCGAAAGAATCATCCGCA
CGCCGCCCCCGTGCGTGTGGCTGGCTTTGTGTGTGGGTGGGTGTGCGTATACAGGAGGAGAGAGAGAAAGAGGGGTCCTCATGCGTGAGCAAAGAGGCAG
CAGCTGCACCCCCGCCGCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCGCGCAGTTCGTCCCCATTCGCTCGCGCGTCGGCAAGCGCTTTCAGGCCGTGATCCCGGACATGCTGGACGACGACGCGCGTGCCGTCAAG
AAGCGCGCGATCCAGATCCCGAAACCCCAGTTCTGTCCTGACCGCGTGCTCGGTGCGTGCGTTTATTTTATTTTGTTTTTTTTTGTTTTCGCGCCTTTTT
GTTTTCGTCTCTTGTGGATGCTTTGCATATGAGAACGACAATTGTAATGGTTTGTCTCGTTCGTTGCTTGCGGGTATTTGTTTGTGGATGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGGCACTGAGCTTGACAAGTATCTCAAGCTGGCGTGCACGTTGCGGGATGGTGCGACGTTCGACACGGAGGAGCAGGTGCA
CACGATCGCGCTTCAGTACCTGCATCGCTTCAACTACAATCTGACGGACGCGGCGTGCTCTCTGTATGCGAGACACAGCATTGAAGTGCCGAAGGCCAGT
GCCGCGACTCCGGATGTCGGGAATGCCAGAAACCCTAGTAGCGCAGAGGAAATGAGCACGTGGCTGACGGAATTTTACCGATGTATGCGGCTCCCGACGG
TCCACCTTGACGAGTTTAATCGGATGGAAGCTTTATACGAGAAAGCGCGGTCGAATCCAGATATCACCGCATTGACAGAAGCTGCAGTACTCGGTCGTCT
TGTTGCTCGGATCGCGAGCTGGGAAGAAAAAAGTATCGCGATTGCGGCGGAAAAAGTGGACCGAGCCGACGTGCTAGCGCTTTTACACGAAGCAGATGAC
CTGAACTTTCTCGTGCCTCGAAAAGAAATCTTGTCAAGCCGGATTCGGAAGTTTGACGTTGCGTTTGCACACTTGAAGGACGCAATCGATCGCGGAAATC
GCCGAAATCAACCAAAAGTGGAACTGGATGAGGTAAAGCATCGTCATCGTGTGTGCGTATGAGCTCTTTTTGCTGACTTCCTTCTGCTTCTCTCGGCTCC
TAGCTGGAAACTCTCTATATGGCTGCTACAGATCCAAAGATCTCGTTTCTTGAAGAAGAGCAGTACAAGGCGATTGTGCACGAAGCGAAGGAACTGAAGG
CAACCATTTCGAGCATGTTGAGTGAAGAGAAAGTGAGCTTGCCGGCGATGCGAGACATCACTGCCAAGATCGAGCTTGTGCCAGTGAACTTTGAAAAAGA
ACTGGACCTCTTCCAGAAAAAGATGCTCTCAGCTCAAAACTGGCTTGCCAAAGCCCGTAAGTGCATTCCGAAGCGCCGAGCGACGCGACGTGGCGGCAGT
GTGGAACCGAAGAAGCTCGACTTGGGTGCCATTCGAGCGCTGGTCGACGATGCGCCATGCGATGACAGCGTAGAGATGTTCGAGATGCAAGATCTGCTGG
AGTGCGCAGATGAATGGGCTGAAAAGGTGAAAAACGCTATCGAAGGTGGCGCGGAGGTATCGTTGGAGGAGTTGAAAGAACTTTGTGAAGAAGGAAATGA
AATGCCTGTCGAGATGGACGAACAGAAATTCCTTGAGGCTGAAATCGCTGCTCGCGAGTGGTGTGCGAAAGCGACGATGATGTTGGCAGCGCGGAAGTCG
CTGAAAGATCTCGAACGGATCGCGGAAGATGCGAAAGCCATTCGAGTCAAATTGCATCCGAAAAAGCAGTTGCGATGGAAACCACAGGTCGAACGAGACA
TCCATAGTGCAATTGACCAGGCGCGCCGCTGGGTCAACGAAGTACGTGACGTCGTGGGTGACTATTCTTTTGAGAAAGTATTCTCCTCGAGTGCATCCTC
CATCGAACAGCCTTCTAGTTCGTCATCCAAGTCAGCAGACGCATCCCACCAAATTCAGGAAAAAGCCAAGAAGCCTCTCGACAGTGTTGGCAAGTTGCTG
GAGAAAGCAGATCGCTTGGTGGTCAATGTCTCTTCGTATATCGATACGTTGAAGGAACTTCAGACAAATGGATCTGCGTTGAGAGAGGAAGTGAAGACTC
TCTTGGAGAGGATTGGACGTCTTCCTACAAAGGACAATTCTGACGCAACATCTTCAGTGACGGCAACGATCGAATTGAACGCATCGGTGGCCGCGACGAC
CCCGAGTGACCATGATGATACTGGTGTTGCAAGTATGCCGACGCAAGTCAGCGAGACGTATGATATTGGCGATTTTTCGTACGCCTCTGCGATGCTCGAC
CGTGTGTACGTGCTTCCGTTCTTTTTCGATGAAGGTGCGGCACTGGAAAAGGTGATTTTGTCGGAAAAGGACTGGGCGCAGCGCGTGAAAGATGCATTGC
CTCCACGGCAGTCGAGAAAGAAACGACAGGCGAAGAACCAGATCACATTGGCTGACCTTGAAAAACTGCTGGTAGAATCGAAAGACTTGCACTTTCGGTT
TCCTGATGAAATGAAGACGCTGACGAAAGAACTGGAAGAGCTCGGTATCTGGCAAATCAAAGCTCGTCAGGCAGTTGAAGTGCCTGTATCTG