Description :
From Genome Similarity Track
Location :
Scaffold_33:456283- 461451
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010858Protein of unknown function
Pytul_DAOMBR144PYU1_G010857Similar to for: cGMP-dependent protein kinase%2C isozyme 2 forms cD4/T1/T3A/T3B (Drosophila melanogaster)

Sequence
5168 bases(100 bases per row)
GTATGCTGCTAGCAGTTCTCTAAAATACTGTTTCGAGCGCTGCCAATCACCTACCAAGTCCACCATTTGAAGCGTACTTTAGAGTCAATCACACGGGCAA
ACACATTTAGATTGAACGCATTGCTGTTGTGCTTACCGTTTTCCAACGCCGTGTATGCCATTTGGCTGCTGGTCACTTCACGCGTGACTTCAGCTTTATG
CGGAGCAAAGAGTGCTGCAAGCCGAGGTTCAGAGAAAAGGGACCACGACGCAGTTCCATCACTGCCACCACTTCTGTTTAAATCCTTGAATCGTGGCATC
CCACTTCTGGTTCTCTTTGTCTTCTCCAGCGCGACGTCTCCATCTGAATGCGCGGCCTCCTCGTAGTACTCGAGCATCTGCTGCTGCGCCACGAAATTGT
ACATCTCTCCGAGCAGAACAGCGTAGTTGAACATGGATACCGACTCGATAAAGTCCAGTTCCAACGCGCGCTGCAGATCCAAAGCTGCTGCATGAAAGTC
GTTGTCAGATGCATGCAAGAACGCCGACAGATTCAGAGTTGAGACGGGTACATAGTTGCATCGAAGACAGCACTGGAGCTGAGTCGTGGCTTCGCTGAAG
CAGCCATTCTTGTACAGCGCGACAGCAAACCAGTAGTGGAACATGCCGTCGCTTTCGTCGGCACCAGCGTCCCTGGTAGGCGATGAACTATCCAACATAC
CAGCGTCACGAAAGTATGTCAGCGCTTGCTCGTAATCTCGCTTCTCCACCAAATGGAGCATGCCCAGCAAAAACAACGCTCGTTTCCCATGGTGCCGCGT
TTCGCGGTGCTTTTCGCATTGCTTGACTACAGCAGAGAGCAAGTCGACCGATTGTGATAGTGCGCTGGTGCCGCCTGTCATGAGCCAGCAAATCGACAGC
AATACCCCAAAGCGACTCATGATATCCGCTGCGACGCCCATGCCGTTGCCAGGATCGTCGTCATCACCAGCTGTGCGGAAGAGTGACAACGCGCACTCAA
ATACACTCGAATACGCACTGATCACGCGTCTATAGTGTGTCGTCGTATCTACTCCTTGTAGTTGAAGTTGGTCGTGTCCGAACGCATTCGCTTCGTCGAC
GTCCTCCATCGTCGTGTCGTGTGTATCTGTTGACTGCACTTGGTTCACCACCCGCTGTAGTGTATAGAAGGCGCTCATCACCGCAGTCTCCAGCATAACA
GCAAACCTGCTGTTGACCTCCACCGGATCATTTGCTACACGTGACGACCGCTCCCCATTCCATTGAGCCCGAGTCGACACAACGCGACGCCACACGATGC
TCTCCGCGACGTGACAATGCGCCAACAGCCAGCGCGGGTCGCGGTCCGACTCGCACCTTTGGAGAATCTTGTGCCGCATCTCGTCCAGCGCCTGTATCTC
TGCCAGCGTATTGACGGCGTCGCCATCCGCGCGCACGCGCGCTGCCGCTAGGAGCTCCTCGATCTCCGCCAACAGCGTCATCCCGATCTTCCTCTGGTTG
TGAATACTTTTGGCGCCAAAAATGGGCAATTACATACAGTATAGTTCTATTGATTGATAACCCGAGTGTTCAACAATGTTGGAGAGCATCCTCTAAATTG
ATACTGATCTTTCAATGCACAGTAATGCAATGTAGTTTGAAAAGGCATTGCATTGCTGCAGTACTTTCATTAGTACATTGTTCACGCCATATATATTGCA
TTGCATTGTGCTCAGCAGTGTTGCATTGCAATGCATTGCATTCTTGTTGTTACGTATCGAGCAGTCTTGAAGTCCGCCCCTCCTCATTGCAATAATCCGA
CCGCCGCATCCACATCCGCATCCACGAGAGCGTCGGCCGCATGGGGATCCTCGCGCGCGTGGCGTTCTTCGGCGCCGTGTTCACGCTGCAGTGCTGCGTC
TCGGTGCTCGGCAACATCTCGCGCGACACAATTTTCCTGCGTAGTTACACGGCGTCCAGCATCGCGGCGCTCACGCTGCTGCTCTCCTTCACCACGGCGT
ACGCGCTCACAGCGGCGAGCCAGATGCTCGCGGCGCTCGCGCAGCGCCACACGCCTGCGGGCGTGCTTTACGCGATCTGCCCGACTGTGCTGGCACTCGG
GCTCTTTGCGCTGGCCGTCGCGTCGCTCGCGCTCCCCGTGCTCGCGCGCGGCCTCTCGGTCCTGGTCTACATGTGGCTCGAGATCTCGGCGCAGCTGCTG
AACCAGCAGTTCTGGGACCTCTGTGCCAAAGCGTTTGACGTCTCGCAGTCCAAGAAATACTTTGGGTATTGTACTGTCGTGCGCTCTATTGGGTATTTGT
ATTGCGTTTCCGCTTATTATGTTGTCTCTGTGTGTACGTGCGTTTGTAATACACAGGTTCATTACGTTTGGTACGACGTTCGGGAGCCTGATGGCGAGTT
TTGTCGTGTTACCGGCAGTTCACAAGCACGCGCTCCCGACCGAGTACAACCTCATCATCGGTGCGTGCCTGCAATTGTTCGTGGCCGGCGTGCTGTATAT
CTCGGCCGAGCAATTCGCGCCAACGTCCACAGGCAGCGAGGCCACCAAGCCTGGCAAGCGACCAAGTAGCTCTACGCCACGCAGCAGCAAATCTGGCAAC
GGAGCGAACTCCCGTGGAGCTTCATCCGCATCATCCTCGTCTTCAGCGGCGATCATCTCGGAGATCCAGACGCGCAATTACCTTAAGCACATTTGCTTTT
TCGATATGCTCGCGACCGTCGTGCGTGTGTTGGTCGACAACACGACGCTGTCGGTACTTTCGCTGCAGGACGAGGACGCTGTGAAGGCGTCGCTGACGAA
GATCAACGCTGTACAGAGCTTCCTCATGATCCCGATGCAACTCGCCTCGGGACCGTTTTTCACGCGCTTTGGCGTCATGTACGGCATCAGCATGCTCCCG
ATCTCTGTGTTCCTGTTTGGCACATCAACCTACGCGTCCAATGTAAGTTGAAGGAACGGCAGTGGCTGTGATACTCTTAGCCAAACTGACATTTCTCTCA
TCGTGGTACAGTCGGTGCATTCATTGGTGTTCACGCGCGCTTTGTACAACGCCATCTCGCTCGCGATCTTTAACCCTGCGCGCGAATTGCTGTGGTTGCC
ATTCAACGCCAGTGAGCGATCGCGCTTCAAGAGCTTTGTGTGCGGTCCCTTTCGGTCTTTGTCTCGGATCTTTGGGGCGGTTTTCTCCATGATTTTGACG
GCTGAAGTTGTGGCTCGTTTCATCGGCGCGTCTTCAGTGAGGTACGTGAATCTGTTAGCGATGGGTTATTGAGTGACAACGATTCCTCACGTTGCGTGCG
TACGTGTTGCCAGTATCATCATGAGTGTCGCTGCCGTTGCATGGTTTATTGATGCGCTGGCTGCTCGTCAATCGTACGCGTCCGAGTTCTACGCATCGCT
GCGTCAAGGATACCTCGACTTGACGTCGCCTCTTGTCGATTTCACTCCCGACCAAGTAGGTCCAGTGGTTATGCGTTATCTATCGGCTTGAGCCTAACAT
ACGCGTGCTTTTCTCGTTGCATGTCTTTAGATTGTGCTCGTGAAAGAAACACTCGTCTCGGGTGCCCAAAACCAAGTGAACTACGTGCTCAGTTCTCTTA
CTCACGAGCACATTGGACTCTTCTCGCAAGTAAGTGTATCCTTCGTTGCCAACGTGGCATACTCATGCTACAATGGTGTCTCTAATGTGCTGCTCAAATT
GGGATAGGAATTACGCGCGCTGTTTTACAAGAAGCACCGCGACGTCTCCATCACACCACTGCATACGAAGCTCCGCTTGCTTAGCTTGCACACAGCTGCG
AAGCGTCAGTTCGTGCTCTCGGCGCAAGAGTCGTACTTGCTTCCGGATCCAAGCACGTTTCCCTCTGGCATTTTTAACACGATGGATTTGATGATGATGA
TCCAGGACAAGTCGCTTGCTGTACCTCGCCAGTTGCGAGTCGCGGCGATTCTGGCAAGCGGGTACGAGAAATTCAATGCTGACGCTGAAAAGTGTTCGCA
GATGTTGAGCAAACTGGTGCAAAGTACGGACGAAGACAAATCTGTGGTCGTGTGCGCTGCAGTCGCATTGCTTCGTCTCTCAGACTGGATGGACGAAGAA
GCCAACGTGATCCTCCAGCGACTTTTGCACGAAGAAAAGGCACTAGAGTCGCGGGTTGTGTGTCTCAAGATCGTTGGAAAAGAACTGCCTGAGCTCTTGG
GCGACGGCTTTTTGGTCTACTTGCTGCATCATTCGTCCCCGCAAATCGTACAGGCTGCCGTCGAATGCTGCTCTCAGAGTGCTCGCAACTCGCGGATGTT
GATTCCCGCACTTGTCAAACACCTTTCGCACTCGACGTTGCGGCCCCAGGTCGTTGCGGCACTGAAATGGTTCGAGCCAGCAGCGCTATGGGCGACACTT
TCTCAGTACATCGAGTCCGCTGTTCGAGATCATGCGCGAGCGACACTTGCAACTATTCCCAGGAGGAAAAACAGTATGGAGCACAAGCGCGAGGCACTTT
CTGGTGCACTCAAGGTACTCGAGATGAGCCATTTTCCGCTCGAGGACAAACTCGGGCTGCTGCTTTCGTTGATTGACACTCTCATCATCGAATCTCCGAC
GGCACCACGGAGTGACTCGAGTGACCACGGAGGCACTGCCACGATGGACATTCTGCATCGCTTGTTTGGCAAAGATGCCTTCTTAGAGGAGCTCGTCGTG
GATTCGTTGCTGACGCTGGTAAATCTATGTCTGCATATCATTATGTTTTCTTTGCTTCGATATTGCCGAGCTTACTAATTACTTACTGCTGTGGATTGAA
TTTGTGTGTGGCAGATAAAGGCGACCAACGAGAAGACAATGCAGACATACTCGCAAATGATGAATCCGCTTCACCTTGCGCTGGATATCAAGATTCGACA
AGCGTACGAAATGCGCCACGTCCTGCAGCTATTCCATCGAATCTGTCCACGCACAGCGACCAACATCGAAGAAACGTCGCCCCTCCTGTTGCAGCATGTC
GAGCACAGTCTACACGATACACTGCGTATGCTGCTGAAGCTCCTTTCCATGGGTTTTCCGAAAGAATTCAATGTCGCTGTCATTCTTGAAGGATTGCGCT
CGGATGGTCCGCAAGTGCTTTCTGCCATTCAGGTACGTGAAAAGATTGCTTGAGTCAGCATAGAGTGG