Description :
From Genome Similarity Track
Location :
Scaffold_26:4561- 40929
Transcript NameFunction/comments
Phyag_g716cathepsin, putative
Phyag_g717hypothetical protein PHYSODRAFT_508417
Phyag_g718hypothetical protein PHYSODRAFT_504907
Phyag_g7192OG-Fe(II) oxygenase superfamily protein
Phyag_g720hypothetical protein PHYSODRAFT_346765
Phyag_g721hypothetical protein
Phyag_g722hypothetical protein PHYSODRAFT_286359
Phyag_g723hypothetical protein PHYSODRAFT_507179
Phyag_g724hypothetical protein PHYSODRAFT_354853
Phyag_g725eyes absent family protein
Phyag_g726peptidyl-prolyl cis-trans isomerase, mitochondrial precursor
Phyag_g727hypothetical protein PHYSODRAFT_354854
Phyag_g728hypothetical protein
Phyag_g729hypothetical protein
Phyag_g730kinesin-like protein
Phyag_g731conserved hypothetical protein
Phyag_g732DNA repair and recombination protein RAD54

Sequence
36368 bases(100 bases per row)
TCATTGGCACAACTTCGTGTTGAAAAAGTGCAATGGTGCCGATCCAAGCATTCCAGTCTGTATGATGAACGTTCGCTGATAAGGCTTCACGTTGTCAGTC
CACGAATAGCCAAACTCCAGCTAGTTCTTATGAGAAATAATTCGAGAACACCTCCATTGCAGTTAGGTTGGAACATTATCCAACTCGATCGCTTTCAGCT
GCGCTCCACTAGTCGCGTGTTCCTATGGATTGCGTTTGGGGCCGTCGTGTCCTCGGTCCTGTTTGCGTCCTCGAATTAAGACACACACAAGCAGCACACG
TGTGCGGTTGAAACTCAATCGAATAAAGGCTCAGGATGGCATCTCGGTGGGAACGACCCTGAGCACATCCTGACTTCGCTTTCAGAAATTCAATCGCTCG
ACGTCTTGCCTCAAAATTGGGACTGGCGCGACTACAACAGCACCGGTATCAGTCTCACCACGAGTGTTTTGAATCAAATAGTCCCACATGCCTGTGGATC
ATGTTGGGCACTTGCAACTATCAGTGCGCTGTCGGACAGGATCTGTATCGCCAAATTCAAGAAGACCGGTCGTCTAGCTGCAGAAGTATTGCTGTCAGCC
CAGGTACTTCTCGACTGTGGAATGCACTCTTTCGGTTCTTGCCATGGCGGAGACCCCCGATACGCACACAAGTGGATACACGAAAATGGTATCGTGGATT
CGACTTGTAATCCGTACATTGCGTCGCATCCGTCTTGAATAGGTAGTGGGGATTGTGCTGCTACGCAGTGTTATACTTGCACCTTGGAGGGAGATTGTGT
TGTGGTAGCAAACACAACGAAATACCATATCTCGGAATACGGCACGCTGAATTTCACGACATCGGAGGAGTTCCAGCTTCAAGCAATGTACGAGATTTTC
CACCGAGGCCCGATCGTTGTGAGCATGTACTCGTTGACTCCGGAGTTCAAGCAATGCAAAGGAGGATATGTTCTGCGAGACTCGGAAAAATACCCCGGTA
CCACCCACGTCGTCAGTATCGTCGGTTGGGGCATCGAAGCCAAGGCTGGAGTCAAGTTCTGGATCGTGCGCAACTCGATCGGCACCCATTGGGGTGATCA
AGGCTACTTCTTGGTTGAACGGGGCACAAACACGTACAACATCGAAGACAAGGGTGCGTGGGCGGTCCCGTCGTTTAGGATCATCGAAGGCAGAGCATTT
CTTGTTGGCAAGAGTGCTGCGGTATGCTGATCTTGAGTTGGCTGCCCTCACACCTTGTTGAGCTTGAGTATTTTGACCACCTCAGTGCTGACCACTCGTA
AAATCTTAGCAAGACAAGTTTCGGTCAGGTTTCTCACCATAACCCAAGAGTCTTGGGCCAACGCGAACATCATTGCACATGTCTTTCGACGTGTTGGTAT
CtagttcttgctgcagatCCGCCTGTAGACGGCGATGCTGTCTTCGTCAAGCTATCTCCAATCACGAAAATTCTTCCGGATACGATATGTTTTGATACAC
GACACGGAACTCTGTTTTGTAGTTGCAACTTCACCCCAACGAAAGCAAATCCGGGGCTCTTGCTGGTCATTGGGTACCGGTAGCAGCATTTTGGGTCGGG
TAGCCCGTGCTGGCCGCAACACTCCAGCGGATTTGGTGGGAGAATGAGCAATGCTCGGTGGAGACTATGCCTGACCGTTACACAAGCATAGGACTTCAAG
ACCAGCAAACATGTTCTGTTTGCGCTGATTGGCGCGTGGCGGTTCGCTAGCCAATCGCATCGCGTTGCGTCGCGCAAATGTATCCATGTTCTCTCGCCAC
GTGCACATGCCCTTCCAACAGAGAAGAGACCCCCTACAGCAGAGAGAACATGGCTCCTCTCGCTCGAGAAGAAAGCGGCacctgcaattgcagcactTCG
CAATTCTCCCCCAAGGTTCCAACAAGGCCAAGCAAGTTCAGTGCAATGGGGGTCTCCGACAAATCCGATCTCCCGCTGTTGCAGTCGCGCACTAGtcaaa
cttcaacttcaccgTCACTGCTACGATCGACCTACGACAAGATCCGAGATGACCGCTACAAGCTGCTCTCCATTGGCTCTGTGATTGGTTGGGTCGCATT
GGGCAGCTTTATCAGCTCGGCGGTGCTGACATCCACGCAACCGCAACTGGTCGACTACACTCACGATGGTGTGTCAATGCACGCTGTTCAAAACCAACTC
GACTTGATGGCAGCTTGCACCGACACTGGCAAGGGTGAAGGTGGCGTCGCCGAGATCCAAACCAACAAAGGTGCTGGATGGTTCCTCGGTGGCAACGACC
CCGAGCACATTctgacgtcgctgccggaAGTGACGTCGTTCGACGAATTGCCCGAAAATTGGGATTGGCGCGACTACAACGGAACGGGGATCAGTCTCAC
CACCAGCGTCATGAACCAAATGGTGCCTCGCGCCTGTGGGTCCTGCTGGGCGTTCGCCACAGTCAGCTCACTGTCGGATCGGATTCGGATCGCCCAGTTC
AAGAAGACTGGGAAGCTTGACACCGAGACACTCCTGTCGCCGCAAGTTTTGCTGGATTGCGGGATGCGGTCGTTCGGCTCCTGCCATGGCGGAGACCCCC
GATACGCACACAAGTGGATTCACGAAAATGGAATTGTAGACTTGACGTGCAACCCGTACATTGCATCGCATCCGTCGTGGATGGGAGGAGGTGACTGCGC
TGCGACGCAATGCCACACGTGCAATCTGAAAGGCGAATGCTTCGTGTTGGAAGACCCTGTCAAGTACCGTATTTCGGAATACGGTACACTCAACTTCACA
ACGTCGGAGGAGTTCCAGTTGCAGGCGATGAACGAGATCTACCATCGTGGTCCAATTGTAGTGAGTATGTACTCGTTGACGCCCGAGTACCGTCAGTTCA
AGGGAGGTTATATTCTACGCGACTCGACTAAGTATCCCGGCACTACCCATGTTGTGAGTATCGTCGGGTGGGGCACCGATGACGAGACAGGAGTGAAATA
CTGGATTGTCCGCAATTCGGATGGCACTAACTGGGGCGAccgcggcttcttcttggcagaGAGAGGTGTCAACATCTACAACATGGAGAGCCACGGCGCG
TTTGCCGTTCCAATCGTGTAGAAGTCACAAACAAGTTACAAATGGGACTATCTCACAAAATTACGTTCTGGTCGGACTATTTACATTTCACAAAAATCGT
TAGACTAAAAAAAATATGCGCCTCACATTTTGAGCAAGTTGAtgtcgacgatgctgccTCGGTCGTGGAAAACTTCGTCGCGTGCAAGCGTCAACTGCCG
CTCTCTGAGCGTTTTGAGCGGCATCTCGGAAGACCTACTCGTTAGCACAAGTATCGGCCACCAAATCGGTGGGGACTCGCACGATGCGTTGGTGGACAGT
TTGGTCCGGACGAATGTAGTAGCGGCTGGTTCGCGACTGGAGGCGGCGTTGAGGCGTGTGGACCGTGGGGACTTCGTGGCGCCGGAATTCCGAGCCTCAA
GCGACCGATACGCCAATCGTCCACTGAAGATTGGCACAGTGGCTACAATTTCCactccgcagcagcacgcgcaggtGTTGGGACTTTTGGAGCCGCATCT
GCAGCCTGGAATGACGGCGGTGGACGTGGGTTGCGGCTCGGGGGTCCTCGTGGCTGCAATGGCTCACTTGGTGGGACCCTCGGGCTTCGTCACGGGGTTT
GATATTGTCCCAGAGCTGGTGGAATTCTCGAAGGAGAACTTGCAACGCAGTCTGGGCAAAGCGGCAGCTGAGAAGCAGACGGAGATCATCGTGAGTGCTG
GAAAGAAAGACCTTGGGTTGCCGTCGGATGGTCGGTATGATTGTATCCACGTTGGTGTTGCGGTGGAGACCAAGGCGGAAGCGGAGAGCTTCTTGGAGTA
TCTGAAGCCTGGTGGTGGGTTATTGATTCCGCTTGGAGGTGCGGGAACTGAGCAGAAGCTGGTTAAGGTGAGCTGTGTAGTAGTATGTGAATGAAGCATA
AGGCGGTGATCTGACGTGCCATTTGGTGTACAGATGACTAAACTGGCTGATGGAATTGTGGACAAGCGAGACATGATGAGCGTCCTTTGCCAGCCGATGC
TGGACAGTGTCCCTGTGGAAGTTATTCAGGAAACTCGAGTTGAAAAATTGGCACGCGTGGAGAAAGCCCTTACCCAGTGGCGTGGAGATTTTGAGGCTGC
CAATGGACGGAAACCCACGCGAGACGATCTCATGAGTAACGCTGTGTCCAAAAAGCTTTTCCAAGAGTTTGCAGCATTGAGGAAGTAGACGGAAGCATGA
TCGAGCTTAAGTTGCCAATTCAGTTAACGAGCTGGAGTTCAAGAGTATGGTGCTCACTTTCATTGCATGCAAACGGTGCATTGTCGGACCTGTCACGCGT
GGGCTGCTGCCTTGGTTTTCTGTAGGAGTTGTTCGGCCAGTTCGATCTGGTGAGTGATGTGCTCTCGCTGGGTCATTCTCGCGTATCGTGCTGGGTTTTC
GGGCGTCACGAATTGTGGTAGCGGCTCCACGACAGTGTCTCCGTTGGCGCCGTTAAAGCGCACAATGGACTGACGTTTCTTCTCCGAGTTACAAACGCGG
TGCTGTGGCGTACGAACACAACATAAACCACGTTAGAATTCACCACATTTTGCCTGGAATCATCATTGCAACGTACCTCGGTTGCAACTAAAACACCGTT
TGTCCAGTGCTCGAGCATGTCCCCAACCATGACGAACAGCCTATCGTGTGGAAAAAAGAGCTGGTGACATGATTGATCTTTCATCAAGTTGAATACAGCC
TTTCGTACCTGTCATCGCACACAGGAGCTTCGACCCAATTTCCCTGGCGATTCATCAAGTGCAATCCTTCTCCATTCTGGTGGATGATAGTAAAGCATTC
AAAATCAGTGTGGGAGGCAATCCCCaccgtcgagttcttcgtcgGGGCGTCTGTCTCCGGGTACGTCAGTAGTCGCATGAAGGCctccgcttcttcgtcc
acatGTTGCTGCAAATCCCCAAACAGCAAGGGTAAGTACAACTCCAAAACTGCAATTGCAAACCTCGTACCAGGAACGTGTCGGCTGGCAATCCAAGCAT
CTCTGCGAAACTTCGGAAGAGCACTGTCGACAGCTTGGTGGTCTCCTCGTACAGTCCGTACACTTCCTCTCGAAAGCGTGGCAGCTCCGCCGGCCAGACG
TTCGGGCCCAAACTCGACCCCTCCTTCACAAAGCTCTGCGGGAGCTCACGCGCCAGATCGAAGCCTTCCAAGTGTGAAACCACATCGGGTTGGTACTGTA
GCCATCCAACACAAGAATAGTCAGCAGTTGCCTTTATAATTTGACATACATTGCCATCGTACCGAAGGCTCCTCGAACATGGGCGTCCAGCCTCGAGCAT
TGGGTGAGCGCTTGCAGTGGTATTTCTGCTTAACATCGTCAGGTAGCGCGATGAACTCGTCCGCTTGACGGTATGCCGCTTGAATCAGCTTACTGGGCAT
CACTCCCTCTGTAGGAATCGTGAAGAATCCCGTCTCGATGCAGGCATTACGCATGGCGTCCAGGatctgcgtcttggtctcGGCCGCCACTTCGCGACCg
ttgttggcagcagctaCGAGCGGAGAAACGTCAACGAgcggcagctgctgcaacgccacCTTGGACGCCGTCATGACgcgcggcgacgagaagctaCGAG
CACCCAGAGCCACTCGAGATGAAGGCCGGAGACGTGCACCAAACATGGCGATAGCTAGAATGATGCGCAGAATCGAAGTGTAGCtatccagcttcaactt
gatgtGTGACACACTTAATACCTATCTTATGTCAAAACGACAGCATAGAGACTATCATACAGACTGTAGCATTTGTCCATAAAGCTCCTCACAAACTTCG
GCATGTCGTACctctcgacgtcgacgcaTTTCAACAACTGGGTCTTCTCggcggaggagctggcgcgtgtgcggcgtctgcagcatgtGAAGAGTAAGCG
TGCGTTGCGTCTGGAGCGTGAGGAGGCCCAGAAGCCCGAAGCGCCAGCTGCAAAACCTCGCAAAGCGCGATCATTTGCTGCTTTGGTGCCGAAGTCGTCG
ACTGCTGTGCGCGATTCCTTCGATTGGAatgacgaggtggacgtggAGTTATCAAcactggaggagacggaggagaaggccaatCTACAgctgacgccgc
tgctggagttccTGGACCCGGAGCAAGAGgcgcttcttcgagctttctacgaggagaagatccaggaaagctgcagtgctcaGTTCTTGCGCACATCGGA
CAAGGTTAAGTGTTGCGCtatgctgctgttcaagaGGTTTTACCTGAGCAACAGTGTGATGGAGTTCCACCCGAAGTATCTCGTCCCGACAGCCATTTAC
GTGGCTGGAAAAGTGGAGGAGCAGTACATGTCGGTGGATACAGTCGCAGATCAACTCCATGTGGACCACAAGTTCATCATCGGACACGAGATGATCTTGC
TGGAAGGTGTGCGCTTCCAACTTATCATGTACCACCCGTTCCGAGCGTTGTTGGGGTTTTTGGACGACTTTCGAGCATTTGCCAAGCAGGTACTGAAGAA
GGATCTGCCGGCGACGGTcctgcaaaagctgcacgCAAACTCGACAGCACTGCTGAATGATATGTTGCTTACAGATCTGCCCCTGCTGCACTACCCGTCG
TatttggcgttggcggcgctgtggCATGTGACGGATGAAGtggcatccagcagcggagAAAAAGCTGGCGGGCTCACGAATGCTGATGTGCTGGACTACG
TCAAACGCAGCAAGTTCTCTAAAGATCAGCCAGTTGACGAGGTCTCAGGTCGGCTGACGGAGATTACACAAGCGTTCCAAGCGCTGAAAACAGAAAAGGA
GAATGGCGGTGAGGAGGCTGTGCTTCGTCGTGCCAAGCAAGTTAAGATTATctacaagaagctgaagcagttccacaaggacgacgagaagaaagacaag
aagaagaaaagcgacggcaagaagaaggacaagaagcgcaaggacGGATCCAAGGACGAtaagaagaaggtgaagaagcacaagaaagACAAGGCTTAAT
TAAACGCACGCAGTCTCTAATGACTGTTAGTGTTCGATTCTCAAGACAATAGAGCTgaacgctgcagcgcaataTCATAGTACATAGGATTGCTagtcgt
ccacctcctcggctgcgtcttcttcctcctcttcatcgtcgctaccttcttcctgctgctccgctGCAAGTTTTTCTCCTTTATCATAAAAAAACGCATC
CAATAATTAGGCCACCATTTAGCACAAGTCTACCAAGTTAAACTGCAACGTACTCAGAACCTCGACGATGGCGTGCTGCGTGCGTCTCTCCAGTTTCCGC
AGCATGGGCGCGATATCGCGCTCCATATCCCAATTTGCGCGTTTAGGCGCgaggttcagcagctcgtcttcgctctcgtcctcgctcTTAACGTCTTCCT
CCTGAGCTTGCGCCACTTTCTCCACTAGGTCTTCTACCTTCTCGTCGGCTTGGTCGCCGTCGGTCACATTCGCGTCCTCCTGGTCCTTCGGTTGCTTCTC
CATGGGCTCATTCGCCTCGGGCTTCAATGCCTCAGCGACTAGCGCACCTGCCTCACCATTGCCACTCTCGCCGCGGTCTTTGCGGGCCTTGGcctcacgc
agcagcttcagccgcTTGGCGCGAGGCATCGCCTCATCCACATCTGGACCTGCCATTTCCAAAGTTGTCTTTATAAATGAATTTTGGGTTTTGTAAACCC
AAAATTCATTTAGAGACAGCTGGAATGAGCCATGTTAGCACAAGATGGAGGATGGTGTCACCGGTACTTGGTGCTGATGAAATGGAAAAGAGGGTTGTGA
AGCTGAATCCGCACCCATCCATGGAGCAGATCAGGCAGCGCTGGACAACGGTCGAGCATGCGCAGAATTATTATTGTTGTCTCCACGCCGTTTTCCTGTC
GGCAGGATCGAGCGCATtccaagatgcagcagaagcactATGAACTAAAGAATTGCAACTGTATATGAGACTTGAACACACAGCACTTCTTGCTGTTCAA
AGGTCAAAATGGCATTAGTCCTACATCTCCTCAACTGTAAATAAAGAAGAGCTGACCGACCGCGCGCTGCccaccatcgccaacgcGAAGAACCAAAGCA
CCGAGCTTTCACCCTGAGGTCTCGTCAGCCTTCAACCCTTGGAAACCGGACGGGACAGCAGCCGGTCGACTCCACCACTCGATGACTCTTGACCTTCCCT
CGTCGCGACTCGCACTCTCGACACTCACGCAGCCGTCAAGCCAATAATACACCATATGAATAATGCAGAGCCTCCTCTGCTGCCACCAGGCGAAGCCCCC
TCTCCTTCCAAAGAAAGAGAGCAAACCTCGCGGCTCGAGCTTCGACCGACTGAGCCGGGCCCCCAGGCCACCAATCCAATCATCCACCGTACGCTTCACC
AAATAGTCcaacttcctcctcttccaccaggtgaaggagacgcaCGCGTCGCGCTTGCATTGATTCCTGGGAGCCAGGTAGCAACAGAGGAACCCAAAGC
CACCAGACCCGTCAGCTTCCCACTTCCACATCCTTTCCTCCCCCAGcttccatctcctcctcttctctcGCGTCGCTCCTGGTCGCCATCGTCCCACCAT
TACCGTCGTCACCTCTTCGTCTTTCACTTCGGCAAGGGCAGAACGACTTCCACTTGGTCGACCCCTCCTTTACTTTGCAGCCTCCGACTGGCGCAGGTGT
GCAGAGCACAGTCCTTTGCGTCGGCAAGGCTTGTTGCAGCCCTCCATGGTGCAGCGCTTGCCGCCACCATGGGTAGCACACAGGCCTCCACCACGGTCGT
TGCGCATGCAGCCTGGGACCTCGCACAGACGCGAGCCACCGTGAAGCGCGCAGTAGTCGCCACGCTGCGTGCCCTTGTCACACCCGTCGAACATGCAGCG
CTTGCCGCCACCGTGCGAGCGGCAGAAACCGCCGCCCTgcgagctgcgcgcgcagcCAGCGAACTGGCAACGCGGGCCTCCACCGTGGGCCTTGCACAGG
AAATTCGACTGCGCGGCCTTGTCGCATCcctcgtggctgcagcgcttgccTCCGCCGTGACGGATGCAGAGGTTGCCGCCCTGCGAGCTCTTGTCGCATC
CCTCGACAGCACAGCGacggccgccgccgtgcgAGATGCACAAACCattcgagcgcgagcgcttGTAGCAGCCCTCGCTCTTGCAGAGGCGACGGCTCTT
GACTTCACCGGGCTTCATCATCTTGGGCGCCGCCATGTGGGGCTCTGGGCGACGCGGGGTCATCATGAGCTCCGAGTCCGTGAAGTCAGCCTCCAGCGAC
TCCATGAGTCCGTCAATAGGCGAACCCGCAAGCACGTTCAGGTTCAAGATGCCGTCGTCCATCTCCACGGTCTGCTTGGACTTGTCCTCGGGCGCGTCCA
CCAAAAAGCTGTACAGAATCGACATCTCCGTACCGTCAAAGCCGTCGTCCAAGTTCACGAGGTCGGGCTTGTCCTTGCCGACGTTCTCCAGGTCGCCGGG
CATCGagaagtccagcagctcctccagctcctgggCTTCGAAGTTGGGCTGAGCAGCGGCGCTCGTCTCGGGCTTCACCTCGGCGGGGGCCGGGGCGGCC
GCAAACTGGTCGCTGGGCAGCCCCATGCTCAAAAGATCCGTCGCGGGGGCGGTGTTCCCCCACGGCATCGCGGGCAGACTGCTGGTCTTCgggaaggaca
cgaagggCAGCGCCGGGGGCGGCGCTGCCATGCTCAGCATGTTCATGCCGTCGGCGCCGAAGCCCAGGTCTCCGGCGGCGGTCCAGGCGGGCGCGCGGCC
CGCGGCCTTGGTGTTCTgcgtcatcatcgccttgctgttgcttgcaGCGGGCTGGTAGCCAGCGAAGAGCGCGACGGCGGCCGGGCCCATGGCGCCCAGC
GAATCGCGTGACTCTATCGGCCGGCACATTCTCGGGCTAGCGGGGCCTCAATGGCGGTGGTCCTGTTTTCCTGTTcactctctctcttcttcgcaCTTTG
CGTTCTACGGGTCGCCAGCCGCCGCACAGAATTGTTTCCACGGGCCCTTGCTTGCTGGTCAAACGGGCTAGGGCAACGGCGCATTTTCGACGAATCGTGT
AGCGCCCAGATCGAGTCAGTGGGATGGGCAGAGGCTCGGGGAACCAACTTGACTTGGAAACTCTAAGGCCGCGCGACCACAAAGAAACCGCACCAATTTA
CGGGCCCACTGTGCTTTTATTGTTGGATACCGCTCCTCGTCGCAAGTTGGTATTGGCGAAAAGCATGCCGGCGATGTCGGCGATGTTCACCCTATCTTGC
TGCGAGGCGGTCACTCGTCGTGGCCGGGCCGAAGGGCCCTCGTCGCGGAGCCCGTCGTACGATAGATCGATGGTGGCCAGTGCGACTCGTTGGTTTATAG
ATAGCGATGCACTTGCGTGCGTTGCCGAATGCAAATAGAGCGATAACATCGTTtcaccgtcgacgagaaaTAATATAACCAAGCAGGTGTGGGCCACATG
AATCTTGTGTGGAGGTGGTGTGGCACACTGTTTGAATCAAGCACCTTGAAGCGAAAGAACAATGGAGGCACACGTCGACATCAAGGAGAAGCTACTGCCC
AAGATTGAGCCGATCGTACctcagcgccagcgccagcgagtGGGCGGGAAGGCCCCCACGGCCTCTAAGCCcggaggcggtggcggcagcaactccagca
gcagcaacaacaacaacaaccctCCAACCCACCCCGTCGGATTCGGGCGCACAGGTCAACTGCGCCTAGCGGCGTGGCTGgtcgccatctcctccttcat
gtGGGGATTTACTATGGCCGTGCTCAACGTCTGCATCGTTCCGGATGCTGTGGGCTCTCTGCTTGTGGATATCAACCTTACTAcagaggagcaggagcgg
GCTACAGCTCTCGTGGTGGTTGGTTGCATCCTCACGGCGCTTACGACGGGAAGTGTGGGGGCACGCGTGGGTCAGAAGAAGACCATCCTATGGAACAATG
TGCTGTACATTACCGGCAGCGCTTTATGCGCGCTGGCAACGTCAAAGCGCGTGCTCTACGCTGGCCGACTGGTCATTGGGTTGGCGTCAGGGGTTGTCAC
CAACACAGTGCCCATCCTGTTGACGGAGATCTCGCCCGCTCCTTCGCGCGGCGAGATCACGTCACTTCATCAACTCAGTTTGACGATTGGCATGTTGATC
TCAGCTGTGCtgggcttcttcatcatcttgaaCGTGCCGTCGGGGTGGAGATATCTCAATGGGTTCATGatcttgccgccgctgctgcagtgtttgACTG
CGTCGTTCGTGCCGGAAAGTCCGTGgtggttgatgaagaaccGAGGACAAGATGAGTGTCGTGCGATGCTGGTGTACCTGCGTTCGAGAAAGCAGAAGGA
TGCGATTGAAACAGAAGTGCAGGAAATTGCTCGTGTCATGGAGCACCGCCAGCACGAACCTCACGTGACATGGTCGCATCTATTGGCACACAAGAAAGTT
ATGGTAACAGGGACTGTTCTCGTGTTTTTCCAAGCAATGACCGGTATCAACACGGTAATGTTGTACTCGGCCAAGATTTTCCACTTTGCAGGAGTGACCA
ACCCGTTCTTCGCGACAGCAGTCGTAGGATTTACGAACGTGGGCGTCACTATTATATCTGTGCGCTTTGTCGACTCGTACGGCCGGcgaccgctgctgct
catgggcaCGGCCATTATGATCATCGCTCTAGGTGTGCTCAGCTGGTCGCTACTCTACCTCAACAACAACCTTGAGGTACAGGGTATGGTTGCTGTGATT
TCAGTGCTCGCGTTTGTTGGCGGGTTCGCGGTGGGTCTTGGTGCTGTCGTGTGGTACGTGTTTACGTGTTGCTAGGTGTCGATAGGCGCTGTGCTTATTC
CCGTCATTTTGTATATTGCTGCACAGGGTCATGCTAGGAGATATTACGCCGGTACATATCCGCTCTCGAGCGTTTGCGTTCTACATGGGTGTCAGCTACA
TCTGCAACATTTTGATAGCTGTGTACACGCTATCTGCTATCAACTTTCTGGGCCGCGGCTCCAATCCTGAAAAGAACGGCATCGCCAAGCTGTATTTTAT
CCTCAGGTATGAATGCCAACGCTAGTACTTGTTGGTTGGTAATGGGTGATCACTAACACGAGTGTTGTGTGCATTGAAGTATTGTTGCCGCGACATGTCT
TGCATACATGTACGGCTTCGTTGAAGAGACCTCCCACATCAAAACGGCACCTGCAACACTTGCTGATGATCAGAAGTCGCTTTTAGCTGAGGAAGGCATA
GAGGAGATGGATGGAGAGTTCGGAATTCTACGTCAAACGACCGATCTATAACTGCATGATAAGCTTCGCATACACAGCTACGCGGAAGGACCCAAACAAA
AGTCAATCAAGCGTGGCAATTACTTCGAAGTATCAACCTGCTCGgattgctgtcgttgtctACTATCTATTCTGTGCTACCTTTTTTTTCCACGATGCTC
CATGTCAGTGTCTACTGCTTCAGCAGTTGTGCGGCTTCGGCAATTTCCCGCACAGCTTTGGCGACGGAGATAAGGCGTTCACTGTGGTCGTTTGGAGACA
GCGAGTCGGTCAGCGCTCCCATTTTCTGCAGgtacagcaagaagcgaaaaTGTCAGTATGTCAACAGTGTTCCTAGAGGAAAGTGATCTGCCGTGATGAG
TTTGGTTTGTCTGCAAAGATCGAACTGGTAGGTCCATGTGATCGTGCCTCAAAACTCTGAATAAGCCCAAGCCTCAGATTAGAAGAAATGCGGATGCTCC
ACCTGATAAAGCGCGGCAAGAGTCTGGCGGCGAATAGCGTTCACTTCGGCGTCACTCTCAGCGCTGCTGGGGTTCACCGCGTTGTCAATCTTGCGCTTCG
CTGGAGCCAGTAAAATAAACAACGTCTAACGTTAGCTATCTCCAACCAGACCAAAAAGTCTAAtactgcaacagcagcgtaCCAGCTCCGTTTGCGGTGG
TCGTTGCTCGCTGGATTTtcgcctgctccagctcctgcaactCTCTCGCCTGCTTGGCTTGCTCCTCCAAtcggaactgctgctcgataTGACGCCTGCG
TTCTTGCACATACCGAGCTtcagcctccgcctcctctttctccgctgcagcaagttcctCGGCCTCTTTCTcagcctcctgcttcttggcttcctcctcc
gtgacCACGTACTGGTCGCACCTCACACAGAACATCTACCAAACGCAACATAATCCCTTTTAGCTCAGCTAGAGCAACGTTCAAAATGCTCTCAGTCCGC
CGCTCACCTTTCCCTGCTTGTTGCGCATCAGCGGCGTGTAGCAGTCTTCAACGGGGCAGCTCGCGCCCAGCATCGTCCAGCCCTGCAGCATTttctcgcc
cagcagcttgctgGCTTCATCGCGCGAGCGCTTCACTGGTGCAGTCGGATCCATTGCTTTCTCAAATTATAATAATTTTGGCGGGAATAGTTTTCCCGCT
AAAAAAGTAAATAGAGGATAACCATGGCAGAAGATGCTTCGACCGTCCGTGTGTGTCTTACGCGCTGCCCGTTGCCGCCGACCGAAGAGCGCGTGCACTC
GCTGCCATGCCGTATCCACTTTGACGGGCCTGCACCTGTGAAGACCTTGTTCCGGCCGCAGCGTGGCGATTGTTTGGAGGTGGAAGGCGTcaaaaaggag
aagaagagtgaCGGCGAAGCGATGCAAGCGGAGTTCCGCGGCATTCAACTGCAGGGCCAGAAACTTGAGTTGCAGGCTATGGGCTACACTGGTGCGTGTT
GCTACGTGGGACCAATTGAGGCGTGTTAAACTGCGAAAGTCACTTTGACACTAATGTTGTGACTGTACTTGCAGGCCTCGTGCTAGAGGATAGCGGGTTG
CGACacacggacgacgaaggcCGCATCTGGGAGGTGGAAGACCATTTCAAAGAGCTCACGTGGTGGTAGGGCTGCATTACCTAGGTTTGGCTTCCAGAGG
GGTCTCCGCTAACTTAtagtgctgttgctgtatATATAGGGACGTGACAAACCACACGACAAGCGAGacacagcagcttcccttgatgctgcagcaatgg
agcGATGTCTCCTCTGCGGTACGTACAGCCAGTCGTTTGTGTTGATGGCACCTTCAACGAGCGGGCTAAAGTGCCGAATCCGACCTCGAAGCGGTAGCCA
CCACTCATCCTCGCGTTTGTTGTTGCGTGCGTTGTAGATTCACGGGGAATGAATTGAAGACATTGACTTGCAGTTAGTCTGACTCCGCCTTAGTCCCTGG
CAGCTAAAGTCTAATGCACGTCGTTGTTAGGCAGCcttgcttcagcttcagccatTGACCAGCAAACCCTGCAAATGTCCCCAACTGTACAATCCTTGTT
TCCGATTCTGTGGCGCAATCGGCTACCGTCACCGGAACAAAAGACAGTCCATGTTTGTGACGCTTGCTCTGTCGAGAATCGAATTCATTCCACTCCAGCC
CAGCCCGGCTTCGGTGGCGATGGCCTCCCGCTCGCCTCACTCGCGTACGCTCGTGACAAGGAACAAGGCGCTACAAATCATGCGAGCGCAACTTAAGGAC
GCCGTGGCCaagctggtgttgctgccggTAGTGGGCGTGAGTCTGTGCGGGGCCGTGACGCTCCTGTTAGGACTGCAGTGGGTGGAGGCCCTACAGCGCA
GACGCCAGGCGCTCCAATGGCGCACGCGACTGTGGGCCACACTACTGACGCTCctgctgacgttgctgccGTCCAAGCGACTCGAAGCGGCCGTGACACC
AGCGGAGAAGGGGCCCAGTCGACTGAAGAAAGAGGTTCAACTGTATAGTGGAGACAAGAGAGATGCTCATGACGGAGACGCAGTTgggggcgacgacgag
agttATACGTCACGTCCTGCGAAAAGGCAACGGTCCGAGCCTAATGAGGGAGAGAGAGTGGAGAATGTAGGACAGGATGACAGGCAGgatgaagaaaaac
aaaCAGGTGAcgagacgacgtcgacaaaGGTGGTGAAGCCTGGAAGCTCTGTAACGCCGCGTATCCGGAGGCGCGTGTTCATTTGGGACTTGGATGagac
gttggtgttgtttgCCTCATTGTATTCGGGAACATTTGCTCAGACGCACGGCAAGGAGGTGGCGCCTGGGGTGGCTTTGGGAGAACAGATGATGACTTTC
ttgctggcgatgctggagagacacttcttcttcagcgacttgCATGATGCAGACGTGGACCATATTGCTCACGTAGTTGAGACGGAGAATGCAACGGATC
AGCAACAAAAACCTACTGTTCAAGAGAGATACGAGCGGATCCGGGAGATCTACGAACGTCGTGGACATGTGGACTTTCTCCATGATACGAACAGTGAGTG
GTTTGCTATCCGTGGCGCTCTGATTGCAGCTATTGATAATTTCTCAACGGGATGGCTACATGAAGCACGGCAAGTGTTGGAGCTCATTGCAGAGTCGGCA
AAGTCTCGGGTGGAACCTACACAGCCTGAAGCTCATCCCGAGACTGAAAGTATCGACGCGAGCaaagatgaggaagaggtggagaATGTGAACGTGATGG
TCACAAACACGCAACTGGTGCCGGCACTGTGCAAGTGCCTTATTTACCAACTCGACGCGTTCTTTCCGATCGATCGCGTGTACTCCTCGGCGAAGGTGCA
CAAGTATCGATGCTTTCAAACAATCATGGAGAAGTATGAAGCACCGGATGTGGAATTTGTCGCTATTGGTGATGGgcttgaggaagagcaggTAAGTCTC
GCGCTCGGTCTCGAGTTCCACAAGATTCGGTCACTTGTGGATCTCAAGCGACTGCGTTACGACCTGCAGCTAGTCCaggccaacagcaacagttCGACGC
CGGCTTCTGCAGTGGTGGACTCAccagttgttgctgcggcaCAAATGTCTGTGGCCTCCTCCCCCGTTGGCCAGACTGCTGTAGTCTAGGCGTTGAACGT
CACCTTTACTTTCATCTGCGCAGTGAAATAACAAGCCTTATTTATTCATCGAAAGTCTCTAGCCTAGATGTTGTTACGAATGTCTTCAGTGAAGTCTTCC
ACTGTCGAGAATGGTGCAGGGTACGCACGGTCGTTCCTGACGAGTTTCCAAGTTTCCGATAGACACGATAGAGCGCCAACCACTCACCACTCGACCAAAT
GCCACTGAACAACACCATCAAACGACAAGCGATTCTCATGTAAGTTTGCGAAGTCGTTGATCTTGACAAGATACCACATGCTGTTACCTTTGCGCCGGTC
AATCCACGGTTGTGGTGCGAGGGTGATGAAAAACTGTGACCCATTCGTATGTGGGCCTGTGTTTGCCATGGACTGGTTGCAACGTGGCAAGACGAATGTT
AGTGCGAGACAATATCACCACCTAGCTGCAGACAAACGTACCAGTATTCCTGCTGCATTGTGCGAGATAGCAAAACTCTCGTCGGCAAACTCTAGCCCGT
AAAGTGATCGACAAGGGCCGTCTCCTCGGCCATTACCAGCTACGTCTCCAGCTTGAATCCACCCGCCACGCACAATGCGATGCACTGGGTTGCCCTGGTA
GCCCAATTGTTGTgtttcgtcgctgcagtcggGGACCTTGCGTTCACAAAATGCCAAGAAATTTTTGCACGTCTTGGGGCATACGTCGCTGAACAGTTCA
AGCTCTACTCGGGGCAATGCAATACCGTCGACCTCAAACACTAAGAAAGCATAGTGATGGCCCGATAGCTCACGATGGTGCGTCACAGCCTGTTGAGCTG
CTTCCTGCGCCTTTGCCTCCAGCATTTCTTCAGCTTGTGCCAGTTTCTCCCCATAGTCGTTTCTGGAGTTGTCACTGCcttcgttgttgttgaccAGAAC
ATcatcaaacgcagcagcagcaagcagttCGTTCTTTGAGAGCTGGGTTTGTTCCATTGCAaagttgagcagctcgtcttcaccgtctaGTATATCACGT
GAGGAatcgaacagcaaaatgaAAGGCCGAGTTGTTCGCATTAACTCTGCTCGTTTGCTTCTAGGGATCTTGTCttgctggttctgcaggTATTCGAGAT
ATTCGACTTCCATCATCCCTTCCAACGGTGATATGAAGATCGGGTGAATCTTCCGCAGCTCTTGAAGCAACAATTTGCAGCGCTGGTAAGCCTTGTCGCC
CTTTAGGCCCACCAACTCACAGCACTCCATGCCAGCCCCACCTGCAGATGCCATGATAGCACCGGTCTGCGCCTTTTGCTACCGCGAATGCTAActacag
caactgcagcgttaTTTGCGGCACAGCCCCATATACAAAAGCAAAACAACCATAGCGAAGATACAACCCACCGAACACAGTGTTCATTTCCCCCATATTT
CGTGTCTGCTCGACTTGTTCTGCCATTCGTTTTGGTATCAACTCATGAGAGCAACGTAGCACGGAGAATGTGTACCGATGTTAGATGGGAACGTAAACGA
CGTCGCTTTAAACCTTGCTGTAGTCCATCTTGgactcgagcttcttggtctcAGCCAGTTTCCGCGCAGCCTTCATGAAGTCCTCCTCCACAACGTACTC
GCGGTCGGCACGTATAGCGAACATACCTGCCTCGGTACACACGTTGCGCATATCGGCGCCGTTGAATCCGTCGGTGAGCTTGACAATAGACTCGTAATCG
ATCTCGCCCTTTTTCGTGATGGGACCGGAGTGAATCTTGAGGATATCCATACGCGAAGCCTCGTTAGGCAGCGGGATCTCAATCTTACGATCGAGACGGC
caggacgcagcagagcaggGTCCAGAATATCCGGTCGGTTCGTCGCCATGACCATCTTCACCTGTCCAAGAGCGTCGAAACCATCCAGCTGGTTTAGTAA
TTCCATCAACGTACGTTGAATTTCACGATCCGCCGAGGTCCCCTCCGAGTACCGACTTCCACCAATGGCATCAATCTCATccatgaagatgacgcaCGGC
TGATGGTCACGCGCGTATCCGAACATCTCACGGATCACTCGCGCACTTTCACCAATGTACTTGTCCACGATGGCACTGGCCACAACCTTCAAGAAGGTGG
CATTAATGTTGCATGCCAGTGCACGCGCTAGCAGCGTCTTACCCGTACCGGGCGGGCCGTACAGCAGCACACCCTTCGGAGGTTTGATACCCACGCGCAG
GAACAACTCCGGGTTGGTAAGTGGCAGCTCAATAACCTCGCGCAGCTCTCGGATCTGTTCGTTGAGACCGCCGATGCTCGAGAACGACACGTTGCCGGCG
TCCTCGTTCAGCATGTGATACACTGTGGGGTCCACCTCACGCGGGAGGTAGCGCATGATGGTGAGCGTCGTCATGTCCAGCGCCACTCGAGTCCCCGACT
TGAGTTTgctcttctccaccttggcgCGACATCCCACGACGTAGCGTGGACCACTCGACGCCTTCACAATGAAGCggtcctcgtccagctgaCGCAGCAC
TTCGCCGATAATTTGGCCCACACTCTAAGCAAGAATAACGAAGGTTAGCTGACCGCGTGGCGTTAATTCGTGGCGTAATTCTTCGGGTATGTTACCTGCA
GAGCCTTGAGgtcgtcctccgtcttgttGAACTCCTTGACGAGCGTCTTGACGTTCTCGCGCATGCTCTTCACTCTGATTTACATGAGGAATAACGACGT
AAAAGGATTGGTTAGCTGATGAATTCGAGGTAAAGGATCGGAGTGAAGTTGCACAGTTTGTAGAGCATCGTAGAAGATGGTTGTTATATGAAAAGATAGC
GACGCACCTGCTCTCCATCTCACGGTGCTCCATGACCTTGGCCTTGTACGCGCTCAGCACCTGCGCGCGCTCATCTTCCGTCGGGTTGGACGACATCTTC
ACTTGCCGTTTTTGTATCAACTTCTCCCCTTTTTGGATACGATTGCCAATTTTAGCCAATCATCTGCACAAACATATTCTGTTGGCTGAAATTGCGTTTT
CCGTTGGTGTAGCGTGCAGCTGCGTGACGCAGCCTGCGTCTGACTCAGCGGGAAGGGGCACAGCTGAACATAGCTCATCATAGCTCAAGTCTCctcgttc
tgcagcaacatggaCCGATTCCTGGAGGCTGCAGGCCGCGTGAAGCCCTTATCGCGTTGCGAACTTGGCTCTGGCTCATTGAAGCAATGTCTGACATTGA
AGGACTTGGTGGCGTATGGCGTTGGCTGCTCAGTGGGCGCTGGAGTTTACTCTCTCGTTGGTGTGGGGGCACAGATCGCAGGCCCAGGGatctcgctgtc
gttcctcATCAGCGGCATCGCTTGcatcttcacgtcgctcacGTACTCGGAGTTTGCAGCTCGTGTACCCGTACGTATGATGTTAAATTTGAAGGGTTGG
GAGAGGGTCTGAACGTTGTTGTCTGGTTGGATGAAGGTGACGGGCTCGGCGTATACGTTCGTGTACGTTACGTTTGGTGAATTGGCGGCGTGGCTTATTG
GCTGGAACTTGACGCTGGGATACGGCATCTCTGCAGGTGAAAGTGTGCAGTAGTTCGGAGTATTGGTCTGGGTAAACTTACAGTGCTTGTGCTGTCGTTG
GCAGCTGGAATTGCACGGAGTTGGGCGTCGTACGCGCATTTGTTCCTGCAACATTTTGGCATCCATATCCCGCTTTGGCTGGTGCACACAGAGATGTTGG
GACGGTCGTGCAGTATTCTCGCTGCCATTCTCATTATCTGCTGCACTGTCATCCTTCTCGCTGGTGTTCATGTACGTAGCTAAGTGCTGGAGAGATTGTT
TCTCTTTTTATGCTAATGGGTTGATGTGCAATGTACAGGAGTCTGCCAAGTTTAATGctttggtgacgatgctgaaTATTTCGGTGCTGCTTTTCGTTGT
TGCCTATGGCGGCACCGAAGTGGATACGAAGTACTGGGAACCGTTCATGCCTGCTGGTTTCCATGGCGTCATGACTGGTGCTGGTGTGGTCTTTTTTGCG
TACTTGGGTTTCGACATGGTGGCATGTCTTGCTGAGGAGGTGCATGAGCCCCAGCGAACACTGCCCAAGGGAATTATTGGTTCGTTGTTGATCTCGATGA
CCATTTACGTCGCAGTTTCGCTTGTCGTGACCGGAATGGCGCCCGTGGATGTCCTGGGTGGCGAGGTTCCGCTTGTAAATGCATTCAAGTTCCATGACAC
ACCGTGGGCTGGACGCATCGTATCGTTCGGCTCCATCTTTGGCCTCACCACTGCAGCGTTTACCTGCCTCATGGGCCAACCACGCATTTTCTACCAGATG
GCCAAGGATGGCTTGTTACCATCGGTCTTCTCCAACCTACACCGCCGGACTCATGTTCCTGTTGCCAGTACAATATTTACTGGTATCCTAGTGGCATCCa
tcgcgttcttcttcgagctggacTTCCTCGCCAATGTGATTTCGTGTGGAACGCTTCAAGTATTCACCTTCGTTAATGCTGGCGTGCTACTACTACGCAT
GCGCCCGAATGTCAGCGGAGCTGGTGTGATTCACCGTGTTCTTCTGTACGTGGTGTCATGCTTTGCTCTATCGCTATCATTCGTGTTCGATCTTCCCTGG
ACGATTCAAGGCGTGTTCGGTATGATTGTCATTACTTCGTTCGTATTCATATACCGACTCGGCAAACTCAGGTGCGCAGATTGAATTGTGCTACCCCATG
TGAGGGATATACAATTCTGAGCGTTCTATTATGCACGCAGCGATCTGACCACTTCGTTCCAATGCCCACTGGTGCCTTTTGTGCCATGTATGGGGATTCT
TGCCAATGTGTACATGGTGGCAAGTATCCCAGGCGAGGGCTGGTAAGTTACTTTTACTCTCATAAAGTTGGCTCGTGATGCTAACATCGTGCCTGGCTGT
AGGGTCGGCGTGCTTATCTGGTTGAGTGTGGGGCTGATCGTGTACTTGGCCTACGGCACCCGCCACAGTATGCTGCGTGACGATAACGTATTACGTCCGC
TTCTCTGAAGACTCGGGGTACAATAGATACTGCACACTCGCCGTAATACAGAGTGTATCCATgttctccacttcaacatgaccaGCCAATCATCATTTAG
TATCTATTTtcagatggctacatgcaTCAGGAATTGGAGAAATAATAGGAGTGCTGTTAGCACTTTAAAGCATCATGGAGGCACGATCTCTCCCAGTGGA
ATGTCTTTTGCCTTTCCAGTTGCCTCGGCCGGACAtcgatgatgacgaagatccTGCGGAAAGCGATGACGAATTCAGCCTCGAGAACTCCACCAATGGG
TCTTGCgcaggtggcagcagcatgcTTGAGCTGTATCGTCAGGCTGTGCCACTCGTCCAGCCCCAttcaactgcagcgactAAAACTCTAGGAGCAATTG
TACGAGACCGCGAACTAGTAAAGCGCATGCTGCAGCGTCCGCAGCCATATGCCAAGCAGCTCGACCGACGATCTCTTGGTATGTACGAAAGTCCATCAAG
ATCGGCTCCGCAGTTGCCAGGCAGCGAGCAAGACAGCACTCCACAATGCACCAGCAATCGTCGTCTGGCCTTTATGGCCGCATGCGAAAAACTCATGATA
ACATTCGATTCGCAGGTGAAGCACGCTCGACGTATGAAGCTTGTGCAGGTCAAACCGATGCTTCACTTTCATGGACTGGAAGTGGGCGAAGCAGATTTTC
GTCGATGGGAGCAGCGTCTGCCATCTTCAATTTCGTCGGACCCGATGTCAATGGCAGGACCTATGGTCTCTGTTAGCGACTTCATCCAAGGGTGTCAGCT
CTGGTTCACCGAGACGTTCCTTATTAACCATGTGCGAAGCTTAAACATGtggcagaagcagcaacgcgcgATGAAAGCTGCTCATGGGAAGCACAAGTTG
TCGCCATTACATCAGCAGTCACCGACACAAACAAATCAGCCGCCATTCGATCAGCTTGCACACGAAAGCGATGCAACGCGCACATTTTCCTACGAGGCGT
ACGCTCGGcatccaccacctcgaaTTCCCTCACTGAGAACATCTGCctctgctccagcattgcTTCATGCAAAGTACTGCTCGCACAACAAACCCGACCC
TGCAACAGTGGCTGCGGTGACCAAGCTTAAAAatgccaagcagcaggaacgacgaaagaagaaggaggccgaGGCTCTGGCGCGACGGGCAAGACAGCAA
AGCGCAGAGATCGCCCGAGCGTTTAATGCAAGTGTAGCCATGATATCTCGCCACGTACACAACGAGGAAATCCGCGACCACCGTGTGAACGAACTTGAAC
AGCAAATTGCTCGCACTGACCAGACTCGTTACTGGAACCAGCTCCACAAAGTGCACTGCCAGACAATTGAACAGGACGCACGCGCACAACGAGCACGAGA
GGTTTATGCCATGAAggctcttgctgcagaagaactgCAGATGTCGCGCGACTTCTGGTCACTCCGTGAGGAAATGGTCCGCCGCAACAAGCCCCTCTTT
TCGTTGTCAGCTTCCACGAGCACCATTATCCCCGCACCGCCTGAACTGCTGGCAGCACGAGCATCGGCCAGCACTGAGGCAGACCATAAACGCCTCGCTC
GTGTGGAGCGTGAGCACGCCGAGCAGATGCGTagtctgcagctgctggactaCGCGTACGACCGGAAGCGGATGATGGCCGACGCGTTGCAACCTCGTGC
TGATTCTGCGTTGGTCGAAGTGGACGTACCCGACGAAGAGCTTCCAGCTGACCGAGTGGTGCAGCTTGCAGGCGACGAACTCTGGCGccaacttgtccag
cagcagctcgatggaGATCCTGATAGCATTGCGATGTTCGTGCCACCCAGCAACGCCCCGCCTGCAGCTCTGCGTTACTTTGGTACTAGTCGGCCTGTGT
CCAAGCCTGCCTTCGCTTCGGCCGTCGATCGCAACCTGCAATAGGCAAGCACGAAGACAAAGAAAACCACAAACAAAGCAAACATGTGTATCTATTTGGC
AATCAGAGCAAGAACAACGTTCTGGGATACCCGGTGTCGAGGCGCAGCCTTGACACAAGCGCAAAACATGGTCCAGAGTCCCAGCGTCTTAATGAGTAGC
GCCCTTGCTcatcttgaacttcttcttggcgatcgTTTTTGGGTTGAAGTGGCCCTTAcgatgctgcttcttccacttctgACGACCAGCAGTACTCTTA
CCCACGCCGCTGTTTCCATAGCTGATACGGTCCTCCACAGTCTGCTTCTTATCGTCATCGGCGTCAGGAGCCACGAACGTGTGCAACGGGTCGTTGTCCG
TACGGCGCTTGCCGTCGGCGAGGCGCTGCCGCTTGttgtgtttcttcttggtgcgcgCAGGAGCGGGTGGCTGCAATTCAATAGGGACCAGGTAGTCCGG
GATCGTGGCTAGATGAGGCTGCACTGGGGCAGAGCCCACCACCTTGTCGTGCTCTAGCATGTTCAAATCGCGAGGGTTTGCCTGGAAGTGTGCGGCCAGA
CGTTCGGAGTTTAacatctccttcttgacaTCGGCCAGTTGTGCTTCGCGCACAGCCACACGCGTGACAGCACGACGGACATCTTCCACACGGTAGCGGA
AGCAATCAATTTCCTTGAGGTCAAAGGCTAGCTCAGCCGGCTGAGCAATAACGTCGTTACTCTCAGAGCGGACTGCCTGCTGTTTTGCTTGCACACGCTT
CAGCGCACGCTCTTCCTTAGGGTCGTCCTTGCACACAAGAGACAGCGCCGTACCAGAggcaccaccacgcgcaGTACGTCCGATGCGGTGAGTGTATGCA
CGTACACTCTTCGGGAAGTCCACATTAATAACAAACTGAACACCGCGGAAATCAACACCGCGCGAAACACCGTAGCCTTCATCCTCAGCGCGACCACGCT
TAGTGCCAACCGTCTTTTTCTCCTGCTCATCAGCCTCATTAGCctcatcagcatcatcagCATCACCATCGTCCGATGTCTCCTCCTTGTCACTGTCCAT
GGCCTCGTCATTCTCTTCCTTCCCGCTgtcgtcatcctcttcctTGTCACTGTCCTCattgtcctccttctcgctatcttcctccaccacgtcaGATTCA
GCATCCGACTTCTctgcatcatcgtcttcttctccttcttcctcctcgttttcctcctcgtcttcatcttcgtcaccCACTTCATCACGATCCACGCTAT
CATCCGTAGCGATCAAATAGTCAAACAGTCCACGGTTGAACTCCTCAATAATATGCTGACGGGAGTTGTGCGGCAGCTTGGCATTAAGCACAGCACTCTT
GATAACAAACTGCTCAAAGAACAGTTTCAATCTGTACGCCGCGTCCGTCGTGTTAACGAAGAAAATCACTTTACCACTCACgacaccaagacgcagcagc
gcgtacaGCAGCAAATCCTTGTCAGCGGGCTTCACCGGCAAGTAaaactgctgcaactttCCGTCCGTCGCTCCCTCCTCCAGCTTTACCACCGCCGGGT
TGTGCAGCACCGagcgcttgagcttctcgagctctgGACTCAAGGTCGCCGACATGCAGAACGTCTGACAGGCCTTGGGCAGAGCATTAAAGATAGTGCG
AATGTCCTCTCCGTAGCCGAAAGACAGCACCAGGTCTGCTTCGTCAATCACCACCGTCTGCACCGAGTCCTTGAGCGTCAAATGATCAGCTTCCAAGTGG
GCCACGAGGCGGCCCGGGGTGGCCACCAACACGTCGGGCGcgtcacgcagcagcgcctgctgcgcGTTCATGCTCTGGCCGCCCAGCGCCAAGAGACTCA
CCGTGTCCTGGCAGTAGTACATGAGCTCCGTCATGTGGCGCCGcgtctgctccaccagctccttggtgggcaccagcaccagcgcgcGCACGGCCGGTTC
GCTGGCAGCTGCGTCCTGTTTGTGCTGCAAGATCTTGTGCAATAAAGGCAGCGCAAACGCCGCCGTCTTGCCGGAACCTGTTCGCGCACGCACCAGCAGG
TCTTTGCCCTGCAATGCCAGCGGAATGCAGTGCACCTGCACCAGAGTGGCGTGCACGAAGCGCATCTTGGCCACCGCCTTGGTCAGGCGCCGGTCCAGCC
CGAACTCGCATTCCGCGAACGGCTTCTGcccgtccagcagcgtctcgctcACCTTGGGctgcgccatcgtcgctgcaAGTGATGAAGTGATGGTTGGTCG
GAAGCAGCAATTTTGGTACGACTCTGTGATTGGTTTAAAACAAATTCGTaatttccaccaatcacaGAGTCGTGTGAGTTTGAACTTTTTATtcaaaaaa
aaaactttgGCGCGTATTATCCGATACACCGCGCAATgagcgaggaggagcgcCGTatgtcgtcttcttctaccTCTTCTAGCGCACACGAGGCGCCGCC
TGCGCTGCCGACCAATGTACAAGTAGCAGTACGTTGCCGCCCTCTCAACAGCCGCGAAAAAGCTGCAGGCCGCGGTGCTGTATTGCAGTGCAAAGCCAAT
TCGAACGAAGTGGCTGTAGTCAAGCGCAAGACGTACACTTTTGACCGTGTTTTCGGCCAATACTCGACGCAGAAAGACGTTTTCAGCTCTGTGGTGCGGC
CAGCAGTGGACGAAGCTTTGGCTGGTTACAATTGCACAGTGTTCGCCTATGGCCAGACGGGCACGGGCAAGACATACACGATGCAGGGCGACTTATCTCC
AAACAGCGAGACGGTCGGCATCATCCCGCGCAGTGTTCGCTGCATTTTCGACGCTCTGGAGGCCAGTGGGGAGGAATTTAGTGTCCGTGTGTCCTTTTTG
CAGCTTTACAATGAAGAATTGAAGGATCTACTGGAGCCGGACACGGACAAGAAGTTGAGACTGATGGAGGACACCAAGAGAGGAGGAATTTATTGCATGA
ATCTGTTGGAGgtgacggccacgacggcgaaACATGTGTTCGAGCTGGTGAATACTGGAGTCAAAAACCGTATTACGTCGGAGACGCTCATGAACGAGAA
TTCCAGTCGCTCGCACAGTATTTTCACGATTAGAATTCATAGTAAGGAGCACAATGCGGCGGGGGAGGATTTGTTACGTGTGGGTCAATTGAATCTCGTG
GATCTGGCGGGGTCGGAGTGTGTGGGAAGATCAGGAGCGAGAAACGCGAGAGCTAGAGAGGCCGGAACGATTAACCAGAGTTTGCTCACGTTGGGACGCG
TTATTACAGCGCTGGTGGATAACCTTCCACATGTTCCCTATCGAGATAGTAAGCTTACGAGGTTGTTGCAAGAATCGCTGGGAGGACGAGCGAAAACGAC
GATCATTGCGACCCTTGCACCATGTGCTGATAGTCTGGATGAGACGCTTTCTACGCTGGAATATGCTTTCCGCGCAAAGAGCATTAAGAACAAACCGGAG
CTAAACCAGAAGATGACCAAGGCTGGACTGCTGAATGATTTCGGGAGCGAGATTGAGACgctgcgtgctgctcttcgttcTGCTAGGTTGAAAGACGGTG
TTTACCTCCCGTTGGAGCAGTTTACGGATATGCAGGAACGATTGGCTGGACAGGGTGGACAattgacggagctggaggataTGTTAAAGGCGAGGAACGC
ATCTTGCAAAGAGCtcgaggaagcagcagagaaACATGCGAGCGAAGTGGCAGCGCTGACACTTGCCAAACAAGACGTGACCGACAAATTAACTGCTACG
GAAGGTAAACTTGAATCCACGAGAGGAACGCTGGAAAAAACAacgcaaaagctgcagcaagtgcaggcGGTGCTGAAAGCTTTCCAGGACAACGAACAGG
TGCTGCTTGCACacggagctgttgctgcgacGATGTACAATGCCAGTGAAAAGCGGACCGGCCACCTCGTGACAAAGATTGGTACGCAGGTTTTATTTGC
TGTAGGATTTTTGGGTTTCTTCAGCTAATGTTTGTTTCTACTTAATTGCAGAAAGCACTCAgcatgcagaagaagctAACACAGCGCTGGCAAATGCGTA
CCGTAGCGACTCGCAATCCCAGATTAATGCGTTCCTGGAGCGTTTGGCAAAGCACaaagaaagccaagaaggcgtGTTTCAGGACGTTTGCAACTTgttg
cacgagctgcaaacTGCTCACTCAACAGACGTGGATGGGTTGGTCACAAGTTTGAACGCGCTTCAAGGCCTTGTCGAAGCGCGTAAAGCTCAAGCTGCCG
AATCGCGCACTCAAGACGATGCACTAAAGCGCGGACAGCGTGATGAAGTGGCCAAATCGATCAACAAACAACAGGATGCTGTTCAGCACCAGCTTGAAGA
GTTCGTGGAGATGTCTAGGAACCAAGCGACGGCTATTAGGGAAGACTTGGCCAAGTCTAAATCACGAAATGTGTCATTCCTGGAGGACGTACAGTCGACG
CTAGAGGGTTCTCGACAAGAGCTGAGCAGTTTCCTAACCGAGCAAAGCGATAAATTGCTAGAGCTGCAAGTGGCAATTGACATGTCGATCGAGAAACAAA
ACAAAGAGCTCGATGATAGCAAGGCGGCTCTCACAGCTGCACTGGAGGACAGTCATACTCTCCAGCAAAATGAGCTGAATGGGATGAAGGCACATCTTGC
TCAGTACATCGACAAATGCATTCAAAGTCAGGCACAGAAGCTCAAAGAGCAGACTCTGGTCATTGAAGAGAGTGCGAAGAAGCAACAGACGCAGCTTGCC
CATGTACAAACCATCACGGAACAAGAAGTAAAGGGCTTCGTGCAGGTCATGGGCAGTCAAAATGCGAAACACGAGAGTGACGCGGCTGAACTTCGCCAGC
GTTTGTCTGAAATGCGAGGTCAGCTAGGGGAAACCAATGCAAGGCAATCGGATCTGGTTCAATCACACGAGCAGAGCCATACCGCTTGGAGCAATGACGT
TGCTGCACTCAGTAGAAAGCACTCGGCGGAAATGTCTTCTCTAATGGAGCAACACTTGCAAGCAGACACTGAAGCATCGTCTAAGAGGCAAGGGCAAATG
ACGCAGTTCTTAGGTGACCATGGCGAGCTCCGACAACTTCTGAATGACGGGTgcaagacgatggaggaaGGGCTACAAGCGCAAATCTCCAACACAAAGG
ACAATATTGAGGTGGCATCGGAAATTGCCAAGGAGATTATTGGCGAGGCTTCTGCGGCGTCCACACAGCAACTGCAAGACATGGAGACTTACATAAAGAA
GAGAAAGGTAAGGCGTGCTCTTATCTCTAGGGATTGCATGACAGCTTCTAACCTGTGGATTGTTCAGATCAACGAACGCACGGGAGCCACTCCAATGAAG
ATGGATGACCGCGAGTTCCCCACTTTCAAGGCCACTAAGGTTTCAGCTGAGCAATTGAATGGAGTGGAAAATTTATCCAGCAGCTATGCCAACCCGTCAA
GTGTTGAGGCTGGTGCTGGTCTCAAACGAAGGAGGGTGAGCGATGCCAGCCCAAGTTCTACCGAGGACGTCACTCCTGGTGTTGACGAAACCACCACCGC
TCCATCCAGCATTGAGACCACCAAGGCAGCCACGACCGGCACTGCATCATACAGCAGGCAGGAATCTACGAACCCTGTCGCAGTATCAGCTACCGAGCCG
AGTACACCTTCAAAACCTCGAGCTGAGACCAAGCCAATCACTTCAGTCAACACCACCCcgtccaagctcaagaagacaGGATCGTCTGGATTGCACAGAA
AGAAGCCCGTTGTCGCACACGCACACAGGAGCATGAAGGTGCCCAGTGCAGGCGCCGCAGCTCGAAAGACAACCAAGGCGTCATCTCTCGCAGCCCCGAA
ACGGTTCCGCGCCAAGTCGCCGCTAGGAGAAGCGTCAACCTTCCGTTAGAACTCGGTCGTGTAAGCTTATCCGCTCGATTGCGAGCGTGTCAATTTATCT
CGATGTCGATGAAACATGCGTTGCACTGATGAACACTGTTCATCCATGGCACGCTGACGTACGTTGAAGTGTCCATCCCCGTtgtgattggtggaaaaac
CTTGATGAGTGTAACGGTCGCGATCTTGAGTCAAATAGCTCCTCATTTGACATtttgcagcgatggcgagcaCTGATGCGTGGAAGAAGGCaagcgtcgt
cgctgcggGGGACGTCTCCGCTCAGTTGCCGCAGGGCAAACGGCGCTACTTGACGGCATTCTTGTGTCTCTGCGTCTCTACCATCTGCTACGCCGACCGT
ACGTGCATTTAGCAAAGAAGACATATTATGAATGCCACAACAATTTAAACCTTGTCAATCGTTGCAGGAACCAACATGGGCATTGCATTGCCGGCCTTTG
TGACCAATAAGAAGGAGCAGGGCGAAGTGCTGTCCGCTTTCTTCTACGGCTACATGTGCACCCAGATCCCGGGAGGCTATTTCGCTGCCAAGATTGGCGC
CAAAATCGTGTTGCTGACTGGAGTTATCGTCTGGACGCTGTTCGTACGTGCACTTCAATCTGTTGGTAACTACTGTAGAACCTTAGTAACCTTCGTTGTC
AATGCAGGATCTGTCGACGGTGGTTGTGGTCAAATGCCTCACGTGCCTGTTCTTCACGAGAGCGGGGATGGGACTTGGAGAGGGAATTTTGTTCCCGTGC
ATGCACCAAATTGCTGGCGCATGGTACCCAGTGCAGGAACGGAGTCGCCTTGTGTCGTTGGTGGCAAGTGGATCGGATCTGGGCACCATCTCCGCGCTCA
TCATATCGCCTGCCATCATGGCAGCTAGCGGTTGGCAACGTATTTTTGTTGTCTTCGGCGTGCTCAGCTTCATTTGGGTCGTGGTGTACTTGGTCATGGG
TGTGAGTCGACCCGAAGACGACCCCCATATCTCCACTGAAGAACGCAGCTTCATCGTTCGCAACCGTACAGTTGATCCTGACACGCACCGTCGTCAGAGC
TCACGTGCTGAATTGGATATTCATGCGCTGAATTGGCGTGTACTGCTGACCTCGCGACCTGCGTGGGCAATTTACGTCGCGCACATGTGCTACAACTACA
GTTGGTACATACTGCTGGGCTGGATTCCGCAGTACTTCAACCAAGCTTTGAACCTTGAcctggccaagaagggcgGGTTTGCCGCTGCGCTGCCGTATAT
GTGCGGATACACCGGCACGCTGCTTTTCGGGAGACTCGGCGATCTGCTGGTTACTCGTGGATACCGTGAGTTGCACGTGCGTCAAGCCATGAACGCGTTT
TCGTTCCTCGGATGCgctttcttcctcttctcaCTACGCATGGCCAAAACAGCGCCTATGGCTGTGGCTTTGCTGTGTTTGACATTGTTCACTAGTCGCG
CCGCTATGGCTGGTTACTGGGTCAACATGATCGATGTGGCACCAAACCACGCTGCGCATGTTATGGGAGTCTCAAACACCTTTGGAACCATCCCGGGAAT
CATTGGCAATGTGGTCACTGGTGCGATCCTCGAAGCTACGGGATCCTGGGACCTCGTGTTTGCGATTGCTGcactcgtcctcgtcttcggtgCGGCTTTC
TTCCACTGCTACGCCTCGGATAAATCTATCTactccggcagcagcagcagcagcagcggtagcATCGGGGAAGGTTACGCCACTCCAAGTACcacgtcga
gcagcttcccGGGCAGCCCCGACTACGGTTTGTCTCTTTCATATTCGATTCCCGAGCTTCGCGACGAAACGGAGATTTTGCTGGAGAACCAAATGTGAAC
TTGAACTATTCAACACTGTCGAGAAGGACCAAGGGATGTAGAGCCGTAGCAAAGGGTTAACCCTTAATGTTCATTTTGGCGCAATCTGTACCGACCTAAT
GCGATATTCTGGAGCTGTTGATGCGAGATATCCTCGCTTGAACACCTCTTTTGCATCTCCACGAACAGATCAGTTGCTGCCACCCAGTTCTCACGTTGTT
CCTCGGCATAAATCCGTTGGATATAGCTTTCAGCATCGGGAAACACACGGTAAGCTGTGGCATCCTGCATTGTAGCGAATATTGGAGCCACAAGCTGGTG
TTCTCCTGCACGGTTGCACATCTGCATGACTCGATTGAACACAGCAACGCTGGGTGGGGCTCCAAACAACTCCTGCCAATCGGTGAGCATCCGGACAGCT
CGACGCCATTCACCCAGACTTTCCAGAGAGTCCAATAACTGCGTGACGACAAATACCGGAGGAACTTGACCTGTTGAGATGTGCCATTTGTGGAGAAGTG
TCGAGGTTTCAACTACTCGGTCTTTGTCTGCCAAGGACGTGCATGCCACCAGGTACGCTGAAAAACTGGATTCTGACACAAGCTCACTTTTCAACTCGAT
AGAGTCCTGATCTCGCTTGCGCACGATAAGTCTGTCGAATATGGTGACGACACCTTCGGAGTCCTCATTCACAGTACACGCAGCTAGCGCACGTTCGTAC
GTCGTCATATCAGGCTTCACTCTGTTTCGCTGCATTTCCACAAGTAAGTCGATGATGCTGGCGCGAGCCCACGCAACTTTTTCGCGCTGTTCAACCTCGT
ATGCAGGGGGAACCATCCCCTCTTTATGATCTCCATTTGCCCCCGACGCATCGTCGCAGGACACTCCCTCCCTTGGCTCATCGCTCTCGTCACCAACTTC
ATCATTGTAAAAGCCATCTTCATCTatgtcatcttcttcatcatcgccatcgaattctccatctccaataTCCCAATCACTGTATTTCCTTCGCCACCAT
GCAGCCCGTTCTCCAGCTTTAACAAAAGCTTCTAGCGCTGTATTGTACGAAATCACGTCAGGAGTAACTCCTTCTTTACGTCGGATCACACTTAAGACCT
CCAGGGCGCGTCCGGgaagagcagcttccacgCATGCTAACAAAATGCGGTTGTAAATGCTAATAGAGACTCTCCCAAGTTTCTCTTCCATCTCGTTCGC
GATGTCCCAAGCACTGGACACGTTCCCAACTCGTGCATACGCAAACACCACTGGTTCGTATGTTTCTATCGTAGGCGTAAATGTTCCTGATGTTTCGATA
GCTCGAAAGAGCTCTAATGCTCCATCTGGGTTCTTGGAGTTTGCGCACAATTGCATCGCGCCACTGAGTACTTTCAAGGTAGGCTTATAGTCATTGGCGG
CCATTAAATGATCTAGAAAGTTTAAGCCCACTTCAAACTCCTGTTGACTCGCGCAGGTCGCAAACATCAGCCCGAGAGTAGTGTCATCCGGCTGAATCCC
GCGCTCTTTCATCACATTAAATAGTGCAAACGATTCGTCCACATCACCAAGTCGCTGGTAATAGTCGAACGCATTGTTAAACACACCAATGTCCAACGAT
GCAAGGGATGCGTCACGGCAGGTGGTTGTTATCAACTCTGTCATCCACACCATCAGTTCTCCCTCTTGCCCGTCAATGGAATCATCTATcacatcttcag
cttccacAGGATAGTTGGTGCCCTCATCCGGTATCTCCAAATACGTAGCAAACAATCGAAACAGCAAGTAATACGTTGCTGCCCCTGGATCCAGTTTCTG
ATCTTCGGTGCACCACTCGAAGAATGACAGTGCTTGCATCACAGTGTTGAGGCGAGACTGCGAACTTCCATTGGTGGCACCCTTTAAGCTTGTGATATGT
GCCTTAATCGCAGTATTCATGGTCACTTGATCTGGCAATAAATCGCTCTCGATCATCTCGCTCACAATCAACTCCATTTGGTGAATTTCGCCACGGACCG
CGCAAGCATTCAACAATGCGTTGTAGCTCCAAGTCGTCGGCGCGCATTCGGGTAAAGATTCCGAGTATTTTTTCATCTTGACGAGGACGGACGTCGCGTC
AGTCAACTGTCCTTGTCTCCCGCAAGCACTCAACACGGCATTGAAGTCTGTTGCATGTGCGTTCCTGGTGCGAATTATTTCGTCCAAAACACGTATCTTG
CCCTCCAGCTTCAGAGACAACCGTTGAATAGATCGGTCCGTCTTAGATGGGGATGTGCATGGATGCATTCGCTCGAATGCGCGTTCTACACTCTCCTTTT
GACTTCGTCTCCGAAAGAACGTATCTTGACGCGGCTGTGTCATCTGAGACCAATCATGATCATCCACTGCCCAggccaccgcagcagctaAAGCGTCTCG
CCTTTCAAccaacttctccagttccACCGTATCTCGCACATAGTTGCCATTCTCAATAGCCGacacttcttcatcatcgatTCTGTTCACAAGCGCCAGC
ACATACCCAGCTGAATTCCATTCACCACGCTGGCGGCACGCATCAACCAGCGCATTCACCACTTGGCGCTTCAGCGGCAGTTTTATCGTCTCCTCAACTG
GAAAATCTTTTTCCACATCGCGCAAATACTCCACAGCACCGTTCACATCTCCCTCACCAAGCAGATAATACACCATCGTCCTGGTCGTCACATCATCCGA
AACCAATCCAAACTCATCTCTTGCACGTTTcacaagctccagcatcacctccGACCGTCCAACATCACGCGAATACACCCTTAGCATAGCATTGGTCACC
AAAGTCGTCAGCTTCACTTCTCCAATCACCATTTCATCAAAATACTGCtccgccatcgtcaccaaccCCTTCTTCCGCGCACAGCAATTGATCAGAAAGC
CATAGACCCGAGCATCCAGTTGCAATCCACTGtcttccatcttctccaataCAGTCCTTGCACTGCGTAGATGCCGCGCACGACTGCACGCAGCCATCAC
CACCTCAAAGCTCGTTTTATCTGCAGAGCCTTGAGCCACCATAACGTCCAATAGCGCCAGGATTTTACTCAGATTAGCATTCatcagcgtcttctgctgc
ttgcagtagtgacgcagcaacaaattGTACGAATAAGGCCAGAGCACAGCCTTCTCTGGGTACCGTCgatgcagcgtctccacgaTCCCCCAAGCGCGAT
TCAAGTCgctctgctccagcgcctccaccaATCGGCGGTTGTAGAACCTCCTGCCGCGATCTACAGGCAGCGATTTCTCCACATCCTGCACAATTGAACG
TAATTTCCACGACTTCTTGGTAACTTCCGCGAGTTGATACACTGAATTAGGACGAGATAGTTGGTTGTCGTTTGAAGTCAATACTGCGAACTGTCGAGCG
TGGGAACCGGGATCAAAGAGAGGAGCGCCTATAGTATTAGCACGCAATGCACGCGCTAGTGAAGCGCTGCGTAtccgacgcagcagcgcacgcCGCAAGG
TCGTCACCTGCGCCATCGCTCGCCGCTAGTTGCCAATTATTGTTCGATCTCCCATTTCATTGGTTATTAAATTTCTTATCTTTCCATCCAATCACAACTC
AGAAATGTTGAATCCCTGAGTGATGGTCATTTCTACCTTTTATCCAATCAAACCGCTTCAAACCCTTTCCACATTATAATTTGACCACTTTACCACCATG
CTGCGCCGACGTCcgtccagcacgagcggCAGTACGCACTTCAAGCCGTTCGTGCTGCCTGTAAAGAATAAACCTGCACCCAATCAAGCTCagcacgaag
acgacgacgcgtacgaagacgccgatgCCGCTAACAACCGCCAAGCTCTGCGCAGTGGCGCGTCCCTGTCCGTCAAGCGGCTCCCGTTCCTGTCGTTCCT
AGTGATGGAGCCAGAGCATCGCGCTCAACGCGTGCGACGGCCCTTCAAGTCGCCATGTGGAGAGGGAGGACGCACTCAAGAGAGCAATCGGTTGTTGCAG
GTGAAGACGCTGGGCATGAGGCGAAGATGGGGCTCCGCAGTGTTAAAGCCAATGATACACCACGACCTGCCGCCAGTTGAGGTGGAtgtggaagagctcg
agccTGTAGAAGCAGAACCTCCCACtatagaagaagaagaagctcccgttgctgctgcgtcattGATTGacgctccaccacctcttgTCCTATGGCAGAG
TGAGACCGACCCGGACGTTAAAGTGGTCGTGCCTGAAATTGTGGGCAAATTCTTACGTCCCCACCAACGGGAGGGAGTCCAGTTCATGTTCGACTGTGTG
TGTCAAGTGAGGGGCTTTAATGGCCAAGGATGCATTTTGGCTGATGATATGGGACTGGGAAAGACCTTGCAGAGTATCACGCTCGTGTATACGCTCTTGA
TGACGGGCATGGATATGCAGCCGACAGTGAAAAGAGCCATTGTGGTGTGCCCGACGTCGTTGGTGAAGAATTGGGACGATGAGATCATCAAGTGGCTCCA
TGGACGCGTGAAGACGGTGGCGCTGTATGAGGCGAAACGGGAGACGGTGATCAAAGGGATTAATCAGTTTATTGAGGGGAGTAAACGACCGCGACCTGGG
TTTTCAGCTCAAGTGCTGATCATTTCGTATGAGACCTTTCGGATGCACGCTCAGAAATTCGCAGATACACCAGCGTGTTGTGACCTGCTGATTTGTGACG
AAGCCCATCGACTTAAGAATGCCAATTCGCAGATTAATAAGGCGTTGTCATCGTTGGCGTGCAGAAAGCGTGTGCTTTTGTCTGGTACACCGATGCAGAA
TGATCTGGAAGAGTTTTTCGCTATGGTGGACTTTACCAACCCCAATATCCTTGGTACCCCCAGCGAATTCAGGAAGAACTATCTAGGGCCAATCTTGATT
GGGCGAGAACCGGACTCAACGGATCGGGAACGAGGAGTGGCGCAGTCTTGCTCAGCTATGCTCTGCGAAATCGTGAATCAGTTCATTTTGCGTCGAGGCA
ACATCCTGAACGCCAAGCATTTGCCGCCGAAGCTGATGCAGGTGATTTGCTGTCCGTTGTCGCCTCTACAAGAACAGCTCTACATGCATTTCCTGTCGTC
CAGTGCATGCCGAGATATGATGAAACACCAGAGTGTGAATGTGCTGTCCTCCATCACCGCTTTGAAGAAGTTATGCAATCACCCGCTGCTGATTTTCGAC
GAAATGGGGAAAACCAATACAAAACTTCCTGGTTTTGGCAACTGCGAGCAGTATTTCACAGCGGCGAAGAAATCAAGAAATGGTGGAAATGATGGCGGCC
AGAATCGGCGAGGGGGCTTTGGTGGACGCACATGCTACCCAGATTGGTCGGGAAAAATGCTTTTACTGGACCGCTTGATGTTTTCGATGAGGAAGACTAC
AACAGACCGGATTGTAATCGTGTCCAACTACACACAGACCTTGGATGTCGTATCTACCCTTTGCCACGAACGGCATTTACCATTTGTTCGTCTGGATGGA
ACAACTTCTGCGAAGAAGCGAAAGAAACTTGTGGATACCTTCAATGATCCGACAACGAACTCGTTcgc