Description :
From Genome Similarity Track
Location :
Scaffold_2968:456- 2696
Sequence
2240 bases(100 bases per row)
TTCGAAGCTGCGATGGGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGA
TGGAGTCCGTGGAGGGGGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAGCAGCCACAGCCGG
GGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATTTCGGATCTGAACGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACA
TGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACT
GGTATCGGTAGCTGGGCAGATCCACCAGGAACAAGTGGCCGGATTTGCTGCGCAGCTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACA
ATACTACCATGCTCGCCACAGATCGGATGAATCCCCGCTGGAAAACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGG
GGATCCAAGGTACTGCGGGAACACGTGGATCACTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGGAG
ATGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCC
CACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCTGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACCCCGACCCTGAAGAGAACCGTCGA
GTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGAGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAG
ATCTCATGGACGGGACTGCCCAGGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGG
CAAGAAAGGTCATCCGAGATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGA
TGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCAAGCGTTCTAGGTATTGCATTTATGCATTTGTG
AACAAGACATCGCCAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCC
AAGTGGATGAGTTTTCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGAGGAGAGACACGTGGTTACTGGGAGAAACGCCAACATGGTCGATGGTT
TGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTATGGATCTGAGGATGTTGGATCCATGGATCTGCTAACA
GGGGAGTCCCGTGGGTACTGGAAGTACCATGCCCCGGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCC
TAAATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCGAGATTGTGTTGGGATTGG
TGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTATACTGGCTCGATATTTGGGTTGGAGATCTCGCGGGT
CAAGACGCCATCCTCGGGATGGATTTCATGGTATCAGCCGGAGTAAGCTTGGATCTGGCAGATGGAACACTGTGTTTCCCGGACGAGATGCGGATCCAGC
TCAGCGGACGGCGACCATTGTACGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATTGAGCCCGGAGAAACCTGGGAGCTGCCAGATCG
GTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGAATGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTC
ACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATG