Description :
From Genome Similarity Track
Location :
contig_8:45598- 47414
Transcript NameFunction/comments
g1925.t1hypothetical protein

Sequence
1816 bases(100 bases per row)
GATGAGTTTGCTGGTCCTTTCGGAGCGAAACTAGGAGATTTCCACTATGTTGCAGACCTGCAGGTGGCGCCGTATTTCCGGCGTAAGCGGGATTTCGAGA
TGATGGTGCTGGAGAGCAAGCGACACGTCGAGGAACGAGCCGAAGCATTTTCCAACGCTACACGCAGCATTGCTTTTTATGCGCCCGAGATGGATGAGGA
CGCGGCTGAGAGCTTCTGGGTGCACATGGTGGAGGAGAGATGTCAACGTCGCCGGGCGTGAAGGAGGCGGTGAGAATGCACAGCACTGTCGAGAATGTCG
GGCAACGCATGCCCAAAGAGGACTTGTTGTAATTCCTCTCAGCCGCAAAATACTCCACCAGCACAGCGGCATGGATCTTGGCCAGAGACAGCGTCGTGCA
TATCCCAATCATTACAGCAACATGAGCTTCATACTTCAAGTAGAATATTTGCACGACATCAAGCTTGTTGGTATTGCAGCTGAAGAATTGGTACATTGGC
AGCTTCCGATATGACAGGGCTGAGGAGGAGAAGTAGGATTGAGGCGCAGTGGGGGCTGCGGCGTCGAGTCTGGCATTGCAGAGATTGCGACGATGCAAAA
GGTAGATGACGCAGCAGCAGCGGGGATCAATGGCCAAGGCATGGTTATCAACTCCTCTTGGCGTTTTGATACACATGTCACTAATGGTGCCTCGAATGAA
TGACTACATAGGTCCCGTTTAATAAACACACCTCTTCGTTTCAATATCCTGATATTTTCTGATCAATTATATAAAATAATTCAGTACAAATCCTCTTGCT
TATCTTTAATCCCTCCGAAATCGATTCGGTGCCGACCCTGCGCTTATTGAGAGGGACCTCTGTATCGCGAGTTTAGTTGCCCTGGTACAAGTAACATCTG
CAGGCATCTTCGTGTTTGTTGCTTGGTCCATGGCGCAATGGTTGGCTCCATGCTGATATCAATTGACCTTCGTGTTTGGAAACAAAGGTAACTGGTGCGA
GAACGAATGCTATGCTGGTTGTCGACGTCAAAATTCGTATCAACTGATCTCGCAGCAACGAAAGCAGCAGCGTATCCTTGGGCCAAGGACCTTGGTGACG
TTAAGGCCCAGCATGGAGTGTGGGGTGTACTAATCTAGAAGACACCTGCTGGTAAAGTTCAATCTGCCAAGTAGAAACTAGGGCATTGAAGTTCATTTCA
TTTTTAGGCTCGATCGACAACATCGACATCAACCGAACAATGCTGATGCTGTTGCTGCTCAATGAGAATAGGCAATGTTCTGAGCATTGCTCATGTAGTG
GCCTCAGCGTGCGCCTTGCTTGCTACAGTGTGCTCTAAACCAGCTTGCCCCGATTGGAAGCTTCGTTTCCGAAAACTTGCCAAAGCTGGCACTTTCCTCA
GTTGTTGGTGTTCGTGTTTACAGATGAGGCTGGCGTAATTGAGTAATGCATGCTAGTGAAGTAAACTAGCTGCGTGCGTGACAGCTTCGGGAGCTGATCC
GGCCCCAACGAGAGCAACTTCACCAGAATCACATGGAGAGATCATGTACCAGCAGTCGTTGAATGAGGCTCATGTAGCTTACATTATAAGTGCTTACTTC
CTCACGCTCTGCAAGTCTCTGGGGCTGAGCAACGCTCTGCTTCCTCGCCTGGTTCTACTTGCAGATGTCAAGCCGCCGAACGCCAGCGAAGGTTGTCGAC
GTTTGCTCTTCCTGCACTTCGAGGTCGGCCGATTATTATCTCGCTAATCGCAGCCGTAAAACAATCATCTGCAGCAGAATGCAGATGGCAGATCTTCGCC
AGCATAATAAACAGTT