Description :
From Genome Similarity Track
Location :
contig_8:45597- 47413
Sequence
1816 bases(100 bases per row)
AAGCGTTGCTGATGAGTTTGCTGGTCCTTTCGGAGCGAAACTAGGAGATTTCCACTATGTTGCAGACCTGCAGGTGGCGCCGTATTTCCGGCGTAAGCGG
GATTTCGAGATGATGGTGCTGGAGAGCAAGCGACACGTCGAGGAACGAGCCGAAGCATTTTCCAACGCTACACGCAGCATTGCTTTTTATGCGCCCGAGA
TGGATGAGGACGCGGCTGAGAGCTTCTGGGTGCAGATGGTGGAGGAGAGATGTCAACGTCGCCGGGCGTGAAGGAGGCGGTGAGAATGCACAGCACTGTC
GAGAATGTCGGGCAACGCATGCCCAAAGAGGACTTGTTGTAATTCCTCTCAGCCGCAAAATACTCCACCAGCACAGCGGCATGGATCTTGGCCAGAGACA
GCGTCGTGCATATCCCAATCATTACAGCAACATGAGCTTCATACTTCAAGTAGAATATTTGCACGACATCAAGCTTGTTGGTATTGCAGCTGAAGGATTG
GTACATTGGCAGCTTCCGATATGACAGGGCTGAGGAGGAGAAGTAGGATCGAGGCGCAGTGGGGGCTGCGGCGTCGAGTCTGGCATTGCAGAGATTGCGA
CGATGCAAAAGGTAGATGACGCAGCAGCAGCGGGGATCAATGGCCAAGGCATGGCCATCAACTCCTCTTGGCGTTTTGATACACATGTCACTAATGGTGC
CTCGAATGAATGACTACATAGGTTCCGTTTAATAAGCACACCTCTTTGTTTTAATATCCTGATATTTTCTGATCAATTATATAAAATAATTCAGTACAAA
TCCTCTCGCTTATCTTTAGTCCCTCCGAAATCGATTCGGTACAGACCCTGCGCTTATTGAGAGGGACCTCTGTATCGCGAGTTTAGTTGCCCTGGTACAG
GTAACATCTGCAGGCATCTTCGTGTTTGTTGCTCGGTTCATGGCGCAATGGTTAGCTCCATGCTGCTATCAATTGACCTTCGTGTTTGGAAACGAAGGTA
ACTGGTGCGAGAACGAATGCTATGCTGGTTGTCGACGTCAAAATTCGTATCAACTGATCTTGCAGCAACGAAAGCAGCAGCGTATCCTTGGGCCAAGGAC
CTTGGTGACGTTAAGGCCCAGCATGGAGTGTGGGGTGTACTAATCTAGAAGACACCTGCTAGTAAAGTTCAATCTGCCAAGTAGAAACTAGGGCATTGAA
GTTCATTTCATTTTTAGACTCGATCGACAACATCGACATCAACCGAACAATGCTGATGCTGTTGCTGCTCAATGAGAATAGGCAATGTTCTGAGCATTGC
TCATGTAGTGGCCTCAGTGTGCGCCTTGCTTGCTACAGTGTGCTCTAAACCAGCTTGCCCCGATTGGAAGCTTCGTTTCCGAAAACTTGCCAAAGCTGGC
ACTTTCCTCAGTTGTTGGTGTTCGTGTTTACAGATGAGGCTGGCGTAATTGAGTAATGCATGCTAGTGAAGTAAACTAGCTGCGTGCGTGACAGCTTCGG
GAGCTGATCCGGCCCCAACGAGTGCAACTTCACCAGAATCACATGGAGAGATCATGTACCAGCAGTCGTTGAATGAGGCTCATGTAGCTTACATTATAAG
TGCTTACTTCCTCGCGCTCTGCAAGTCTCTGGGGCTGAGCAACGCTCTGCTTCCTCGCCTGGTTCTACTTGCAGATGTCAAGCCGCCGAACGCCAGCGAA
GGTCGTCGACGTTTGCTCTTCCTGCACTTCGAGGTCGGCCGATTATTATCTCGCTAATCGCAGCCGTAAAACAATCATCTGCAGCAGAATGCAGATGGCA
GATCTTCGCCAGCATA