Description :
From Genome Similarity Track
Location :
Scaffold_373:4559- 7064
Transcript NameFunction/comments
Aphas_H257_19068Hypothetical protein

Sequence
2505 bases(100 bases per row)
GACCCTACTCTACAAGAACTGTCTCGTGTGGATCGACGACATTCTCGTCTGGGCCAACACTCTGGAAGAGTACTTGGCAGTTCTGGAAGAACTCTTTGCC
ATCTGTGTACGATACCGACTACGGCCGAACCCTCGGAAGAGCACCCTCCTCTGCAAGAAAATCAAATGGTGTGGCCGGATCATAGACGGACACGGTGTAC
GACAAGACCCGAGCAGCTGTCGTCACTCTGCAAGATCCCGTACCCCACAACGGCTGGCCACCTGCAACAGTTCATCTGCGCAGTCAACTGGATCCGTGAT
TCCCTCATCGGCTTTGCCCAAGCTGTGGACCCGTTATGAAGAAGCTCACCGAGGCATTAGCTGGCAAGCGACTCAAGAAGCGTACCGCTGCATCGATTGA
AATCGAACTCAGCCACGATGAACGTGCAAGCTGGGACAAAGTCAAGGAACTTATTGTGGCCGCAGTGCAACTGCGCCACCCGGACGAACGCGCGATCATG
TGTCTGTTTACGGACGTGTCCCAGGAAGGGTGGATCATCATGGTGACACAAGTCCAAGCGTTCGACGAAGCGAAGCCCATCCACGAGCAACAGCACGAAA
TGCTAGTGTACCAGTCAGGTATGTTCGACAATACCCAGAGGAACTGGAGCGTCATCGAAAAGGAAGGCTATACCATCGCTTGTGCATGCGACGTGTTGAA
ATACCTGCTGCTGAGGCCCTTGGGATTCCGCATGTACTGCGACCACAAGAACCTCATTCACGTGTTTGCCCCCGACAAGGAAATCAAGGCGCACACACGG
GAGAAGCTACTGCGTTGGGCCGACCTCATCGGCCAATACCGCTACGTGATCGACCACATCGACGGCGTGTACAATCTGTGGGCCGATCTACTCAGCCGCT
GGGGACAACCCGCGCCACTGAAGGCACACGTGCTCCGCCTACATTCTGCGATGCCCCCGATCATTGCCAGCGTCGTATGGACACGCCAGAAGCGTCGAAA
CCACGTACGACAGTTAAAAAATGGATGAAGCGCAAGAAGCGCCACAAGCCAAGAATGGTATACAAGCCGCCGCAGGCAAAGATCCGCCCGCTGGACGACA
CGGATTTTATTTGGCCTGACCTGGAGTCCATCATTCAAGCCCAGAAGGCAGTGGCGGCACCACCAACCGCTATCATGCAAGACAACGGCGTCCTCTACCT
GCGTGAACGCATCTGGATACCCGACGATGCCCACGACCTGCTCACAAGGCTGTTCATCATAGCCCACTGTGGATCGATGGGTCATCGCGGACATCATGCC
ATGGCCAGTCATATCCGACAACTGTTTACCATCTCGCATCTCGATGAGAAACTCGCAGCATTCCTCCGGTCGTGCCTGTTGTGCCCGCATATTCGGGGTG
GGAAGATCATCCAAAGGCCTCATAGGAATACGTGGTCAGCAACGCGGCGCAACCAAGGACTGCACTTCGACTACCTATTTATGGGTGAAACCTGGAAAGG
TTCCAAGTATGTGTTGGTCTTGAAATACGACCTTACGCACTTCGTACGGCTCATTGCCTGCGACAGTCCGACAAGTCAAGTTGCGGCGGACGCAATTATG
GACTGGTCGGCCATGTTCGGAGTACCAGAAGTGTGGATCTCCGACGGCGGCAGCCACTTCAAGAACAATATCATGAAGGCGCTAGCACACCGCCTCAAAG
TCCAGCATAACATTGTCATGGCCTACTGTCCGTGGAGAAACGGAACAGTTGAGCGAGTGAATCGCGATATAATGGCAGTCATGCGAGTCATGCGAACTTG
AACCAGACGCCAGCAGAATCTCTGGGTGGTACGTCTCCAATGTTTGCTTACACTGGATTAGATCCGATTACACCCCTCAACGTCATCGCCGGAAGCGTCA
ACAGGAAGTTGATCGTGGATGGATTGACCGAAGTCAACTGGGATCGACCCAACATCAGAACCGCGATGAGTGCCCTACGACGCAGCCTCGGAGAGATTCA
CTAAAAGATCCTCGACCACAAGCGCGCGGCACAGAACCGGCAGGTCCTCAACAAGACCAACTCGAAAGCGTTCAAGGTTATGGAAGGCGACTACGTGCTG
TGGTCAAGGGTTGATGAAAACTCGCATTACCCGAAGCTATCCGTCACGTGGATTGGACCCTTCCGAGTCAAGGAATGCCTGCCGTACTCATGCGTGATTG
AACACGTCATCAACGGAAACGAGCGGGAAGCACATCACTCAAGGCTGAAATTTTACTCAGACCAGTACCTCGACCTCACGGAGGAAATCCTCGATCACAC
GTCAGCAACCAGAGCGTTGTGCTGACCGTCGGCGCAATTCAAGCTGCCCGACTCGACCCCGGGACTAACCGATGGGAGCTCCTAGTACAGTGGAAATGCC
TTGAAGCCATCGAATCCAGCTAGGAGCAATTCCTTGTGATGTACGGCGAAGTACCACTCCTTGTGAAACAATTCGTTGATGGAATCCAAGACGAAAAACA
ACGCC