Description :
From Genome Similarity Track
Location :
Scaffold_6:455895- 459884
Transcript NameFunction/comments
Physo_318081PREDICTED: isoflavone reductase homolog IRL-like
Physo_336396short chain dehydrogenase, putative
Physo_404843short chain dehydrogenase, putative
Physo_257226Amino Acid/Auxin Permease (AAAP) Family

Sequence
3989 bases(100 bases per row)
GTCATGTCGGTCTACACCAAGTTCGCCATCATCGGAGCCGGCGGCGTCGGCGGCGACATCGTGGACGAGCTGCTCAACAAGGGCGACACCGTCTCGTCTC
CATCCTCACGCGCGACGAGTCCAAGCCGGAGCTGCAGGCGTTCAAGGCCCGCGGCGCCACGCTCCTCCAGGTCTCGTACGACGACCACGAGTCCATCAAG
CGCGCGCTGGGCGGCAGCGAGGTGGCCGTGAGCGCCCTGTCGGGCTTCCAGATGCACGTGCAGAAGGCCATCGTGCCCGCGGCCAAGGAGGCCGGCGTGT
AGCTCTTCGTGCCCACCGAGTACGGCGTGCCCGTGGCCGAGGGCCCTAACGCCGTCAAGAAGGAGGTACAGGACGCGCTCAAGCAGCACGACCTGCCCTT
CGCCACCTTCAACTCGGGCGTCTTCGCCGAGTTCCTGGCCATGTACTTCGGCTACCACTACGCCGAGGGCTACATGACGGTGGTCCGCAAGGGCGAGACG
CCCTTCAGCATCACGGCGCGCAGGGACTTGGCTCGCTTCGCGGCGCACGTGCTGTCGACGACGCCCAAGTCGGAGCTGGCGGGCGCGCGCTTCCGCTTCG
AGGCCGACCGCCTCTCGCCCATGCAGATCCGCGCCCTCGCCGAGAAGAAGCTCAACAAGAAGATCGAGGTGCGCTACGTCGACTTCGAGGAGAACAAGAA
GAAGTTCGACACGGACTTCATGGCCTTCCTCACGACCATCTTCGAGGACGGCCGCGGCGCCGTGGGCACGCAGGAGGAGGTGGCGGCCACGGCGGCCAAG
TACTTCCCGGACTGGAACCCGGCCAAGTACGAGACCTTCATCCAGTAAAGAGAGAGAGCAGGTTGGCTGCAGGGTAGCTGTGATCGTCAGTCAAATGTTG
CTGACAGGTCGGAGATATGAATGCAACGCCTTCGTTGGATAGACTTGCATTTCTTTTGAGTTCGTAACCACTTTTCGTTCCTGCAGAGGAAGATTATGCA
GTCGTGAGTTTTTTTAAGGGAGCGGTCAGGTTAGCGGTAAAACTAGTGCCGTCGGGGTCATTCTCAATGAAGCTTCGCTCTTCGTACACTTCACTACGTT
TGCCGTTGGAGCCATGCCAAACAAGACCGTCTTGATCACCGGCAGTAACCGAGGTCTGGGGCTCTCGTTCGCAAAGTACTACGCCAAAGCGGGGTGGGAC
GTCATTGCGACAACTCGCAAAGGAGCCAACCTTGACGAGGTGCGCACATTCACTTACGTAGCTCCTTAAGATATATTCCGCGCGATTTTCCTTGACGTTT
GTTTTGGTATGTGACCAAGTTGACGGCGCTGTCGCCCTTCAAGATCATTTCCTTGGACGTGCGAGATGAGTCGTCGGTGCTTCAGATGGCCCAAGAGCTC
GAGGAGATGCTGATCGATCTTGTCATCAACAACGCTGGCACGTTTACCGGCAGTGGGAACATGACGTCGACCACCAAGGACGCGCTCATGACGGAGTTTG
AAGTTCACGCCGTAGGTCCGTTCCAAGTGACGCGTTCATTGCTGCCAAACCTGAAGTTGGGGGCGAAGTGGAATGGCAAGAACGGGGCTCTGGTGGCGCA
TTTGCCGTCGGTCTGGGCCAGCATCGAGACTGGCAGCGGTCCGTACGCCTACGCGGCGTCAAAGGCGGCCCTGCACATGATCAACCACCGCATGGCTGAC
GAGATGAAGCGCCACCACATCGCTGCAATTCTGCTGGACCCAGGCTAGTCGCCACAAACCTGCCGCGCAGCAGCTACGAACGCGAGGCGGATCGAGTCGT
GGCCGCCATGGCGCGTATCATCGAGAAGTCGAAGCTGAATGACACCGGCAAGTTTTTCCACTTTGAGGGGCACGAGATCCCGTGGTGAAGATGCTTCGCT
TCGTAGATTTTGGATCTTGAGTTGCTTCAAAACTCCTCAGTTCGGGTTGTAGGTTCCAAGCTACTAACAAAAAAATGTAAGAAATATTCATTCAAGAAAT
GCGATGCAGTCACTGTGATGAACTACAAACTCTGACCGCAGTGGCACATCATCAAGACCTCAGCATAACATTAGACCTACGGAGTTTATGCATGTCTAGG
AAATTCATAATCGTAGCAGTTGACCTATTCGCAAAAGTGGAGAGCCGACCACAGAGTCATTCCGTCGACCGCCAACCAAGCCCAGCAATCATGGCCAACA
AGACCGTACTCATCACAGGGAGCAACCGCGGACTCGGACTCGCTTTCGCGAAACACTACACGATCGCCGGCTGGAACGTCATCGCAACGACACGAAAGGG
CAGCAACTCCGAGCACGTCCGTCCGAAAACTCTCTCAGTATTGTTGTGCATACGCATTGATGCTGACAACAGTTATGCCTCCGTATTCCGCGGGTTAGCT
GAGAGCATTATCGCCATTTAAGACGTCACTCCTTGACGTTCAAGACGAATCCACAGTACTCCAGGCCGCCGAGCAACTCAAGGACACCCCCATCGACTTG
CTCATCAACAACGCAGGCACCTTCACAGGAGGAAACACCATGGCTTCAACTGTAAAGAGCGACATGGTGAAGGAGTTCGAGGTGCACGCGGTTGGGCCTC
TTTTGGTCACGCGCGCGTTGCTGCCGAACCTGAAGCTTGCGGCAAAGGCTGGCAACAAACCCGCCTTTGTCGTGCAAATGTCCACGATTTACGCCAATAT
TGAAAGTGGTGGCGGCCCGTATCCCTACTGCACATCGAAGACTGCACTGCACATGGTCAACCATGTTATGGCTGACGAGCTCAAGCGTGACAACATCAGC
GCGATTCTGCTCGACCCGGGCATGGTGTACACCAATATGCCCCTGAGCAGCTACGAAGCGGAAGCGCTCAAGTTGTCGCGAACGTGATCGACCAGGCGAC
GATGGAAGACACTGGTAAAATGATGGACTACAACGAAACGGTGCTGCCTTGGTAAATCGAAGCATGCACTGCTAAACATCCCTAGCAAAGTGTACCAAGG
CAATACTGACGGGACATCCGTACTTTGATAGCATTCATCGCAGCAGTCTTTGTTTTTTATGAAATCTACACATCCATCAACACATTTTCTCGTCTAGTCT
GTGCTGTTCCGGACGTAGTACGGCTCCTCCTGGAACTCGGGCGTGCAGTAGGGGAACGTGGTGTCGTCGTCGTCCGGGTTGAAGAGGTTCTTGCCGGCGT
AGATCATGACGTAGATGCCGCAGACGGTGCAAATGACGGCGACGGCGACGCAGAGCAGCTTCTCCCAGGCAGGGACCTTGGTCCAGAAGACCATGAGGTA
GAAGATGATCGGCAGGATGAGACTCGACATGGTGATGGCCGTGGCGCCCGTGAAGTCGCTGAGGTCGAGGAAGTGGTCGCGCAGCAGGATGGAGAGCACC
ACGAGGATCACGATGATGGAGATGCGCAGGCCGATGTAGCGGAGCACGTTGGCGCCGCCCGTGTACTCGGACAGGTCGTCCTCGTCGTGGTGGTGGGCGG
CAACCGACGCGCGGGTGAGGCGGTTGTTGCTCTCGAGGTCGGCGGGCGTCGACGAGCGCATGTACGACGACATCTTCTCCTCGATCTCGATCTCGCCGTC
GTTGGTGATGGGGTCCGTCTTGTGCATGCCGAGGATCACGCGCTCGAAGAGGTAGAAGGCCGGGTGCAGGAACGTCGAGAAGGCCATCGACAGGTGCAGC
TGCATGAACAGGTAGGCCATGATGACGGCGCCGCGGTCGGCCACGAAACCAAGAGTGGTGGTGGCGAACGGGTCCGAGGTATTGGCGACCGAGAAGAGCA
GGTTGCCCGACATCTGGCAGCCGCCCACAGCGTAGCCGGCAATAGCCACAGCGATGAAGAAGGCCGACGCAATGCCCAAACTGACCATGATGACACGGGG
CATGCGCTCGGGCTGCGAGTGCTGGCGCTGCAGGTCGGGGATCACCGTCGCAGCGGCGTACGCGAGCGAGAGGTTACCGAACGTGGTGA