Description :
From Genome Similarity Track
Location :
contig_10:45587- 46942
Transcript NameFunction/comments
g2749.t1hypothetical protein

Sequence
1355 bases(100 bases per row)
GCGTCGGCAAGCACGTTCAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATTCCGCGAAGAATGACAGCCAGCGGGCCATCCTCTGAGACAGATGCG
GAGAGTTGGTGGCCGTCCGCAAGGACGCGTGGTCTGTATAGATCACAAAGGGCTCAGAGCCCAGGAGGTGTACCCGGAACTTGACAAGGGCATACTTCAT
TGCGAGGAGCTCCTTGTCATGGACAGGGTAGTTCCTCTCGGCGGCTTTAAGCTGCCTGGACTGGAACGAGATGACTCGCTCGTGCCTCCGCGTCGTGTTG
CAGCAGCGCGCAACCGATGGCATAGTCGGAGGCGTCGCAGACAACGCTGAACGGTTTTGTCTCGTCCGGCAAAGCCAGGACCGGCGCGCGCTGCAAGCTC
GCCTTGATGCTGTTGAATGCATCCTGATGACGGCTCTCCCAGCGCCAGTCGGCATCCTTCTTAAGGAGATCCGACAGGGGTCGTGCCAGCCCGGCATACC
CCGCACTATACTTGTGCAAGTAGTTGGCGAGACCCAACCACTTGCGAAGATCCTTTTGGGATCGTGGTGTGGGCCAGGCCGCAATGGCCTTGACCTTCTC
AGGGTCGGCTCGAACGCCGACGCTGCTGACGAAGCAGCCGAGAACTTTGATCTCTTGTGCCGCAAAGACGCACTTGTCGATGTTGGCATAGAGCTTGTTT
GCTCTCATGACCATAAACACTCGACGGAGGTGCTCGAGATGCACCTCGATAGCCGTCTTGCCTTCCCCGGCACGGCTATGGACGAAGATATCGTCAAAGT
ACGTCTGCGTGAACGCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTGAAAGTCGCTGGGGCATTTGATAGGCCCTGTGGCATCACTAGCCACTC
CCAGAGCATGCCGCTCGGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGCGCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTATAA
AGCTCGCAGCCCGCCATGTTGTTCAACAACACATCCTTGCGGGGAATGGGTGTCTGGGCGGGCACCGTTGCGCTGTTCAGCTTGTTATAAGCATGAACCA
GACGCCACTTCCCGTTCGGCTTGCGAACGCAGAAGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACCATGCCTGCCTTTGCCTTCGCGGCGAAGAA
GGCATCAATGACCTCGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACACAGTACTTTGTGCCTGGCACGAGATCAATCTCGTGCCTAACTCCTCGG
TCAGGTGGGAGTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTTCA