Description :
From Genome Similarity Track
Location :
Scaffold_140:4558- 5650
Transcript NameFunction/comments
Hyaar_Emoy2810875hypothetical protein

Sequence
1092 bases(100 bases per row)
GCGCAAGCGCGACTGGCGTTCGAGACGGCGCGAGTGCGAGAGCGTCTCTGTCAACACCCCGTGGCTATGGACTTGATCAATGGCGTCGTCACGAGTCAGT
CGCTGGTGTACAAGACGCTGGCGGAGACGGTGACGGTGGAAAGCTGCAGCTGCGACTACGACGTGAAGTGGAACGTGGTCATGGCCACGAGCGTCTGTTG
GACGTTGCCGAGCCCGAGAGCGACGGGGAAGAAGCGCAAACAGTTGATAGGCGCTCAGACGAGGGACGAGAGGAAGAAGATGTACACGAAGTACCGGTTC
GAGAGGACGAGGAGGCAGGAGAAGAAGGAGGGAGACGACGGGATGGAGGTGTCGCTCGTCAAGTTCTCGGTGGTTGTGGCGTTTGGAGACGACGATTTGT
CGCCCAGGGAGCTGGTGTACTTTGAAATGGCGTGCGAACATCCGTATCCCAGGAGTTACTACGAGGATCAACATCGTTCAGTGCTATCGGATGAAGAAGA
GAAAGAGGAGGGAGGAGGTGACGACAGAGAGAGCGAGAAGGAGGAGAAAGAGCAGGTGGAAGAGAAGAGCAGCGACGACGAGACGTTTGGGGAGGAACAG
CGCGACTTTCGTTTTGATAACGATGTGCTGGCTGATTTGGCCGAGTGGATGCAGTCGGGCAAGGACGAGCTGGATCCCGTTGACGTCGTTGGTTTCTTCA
TGGCATTGCCGGTGCATGAGGACGAGTGGCTGATCGACGAACGCGTGTGTGCGATTCTGTTTCAAGGTGGAACGGAAGGCGACGGCAGTGATGAAAGTGG
CAGTGAGACCGAGGAAGGGAACAGAGTTGATGCGGTGGGACGGATGGGATTGTAGACTCGGAGGAAGACCTAAGAGGGGCTGCTTGTCTCCGCTGTGACT
AGTACTTTGCTTGACTTCAAGGCCAGATGCTCGTGTGTGCCCGGGTGTGTCTGTTTGTCGTGCCCGAGTCCTTTCATTGCTGCGTGCCTGTGTGCTTCTC
TAGGCACCGAGACTATGAATACTGCGCTAGGAAGCTAAGCTTCACAGAAACTAAAGACAGTCACCTCATCAGCATGCATCAACATCGACTAC