Description :
From Genome Similarity Track
Location :
contig_24:455682- 457104
Transcript NameFunction/comments
g4609.t1hypothetical protein

Sequence
1422 bases(100 bases per row)
AGATGGCCGCCTTGATCCGCTCGAGGAATCCAGAGCACGAGCGAGCCGCCCCTGACCCAGGAATGCCGACGCATCCGAGCGCCAGCGATCCAGGTACATG
ACTGTGCCTTGCAGAGCTGAGATGCTGGAATTCCACGTCGCCGTCTCGCCCGCGTTCACATCCACGTCGGCAATGCTGTCCCCTCCTGAGTGGATCACCA
CCGTCACGTCCTTGGTGTCGGTGCTCTCGAACACGAGGTTCATGATGCCGTCGCCTTCCTTACTCCACGTCCCGTAGCTGCCTTCGAATGCCTCGTCCAC
GGTCGAAAGCCCCAGCGCGTCGTACAGCGTGCCGTCGTCGATCTCGCCGATGAACGAGGTGGGGCCGCACGTCGGCTGCACAAACTGGGACGCCATGTAC
GCGATGCCTGTCGGTTCGAGGCCGCCCAGCACAGTGAGCCCCATGTTCGCCACCTCGAGCATGTAGTCATCTTCGTTCACGGACGCCCCGAGGTCCGAGG
TGCCATCATCTATGAGCTCGTCGATGATCACTCCGAAGGTTTTCCGGAGCAAGTCGCGAGTCTCAAATGCAGCGTCCACGTTTTGTTCGCCAGCAATTCG
CGCATGCAGTTGTTGGTGGCCGTGGGGATGTCGTACAGCACAATCGATGAGTTGCTTATACTCACGCGGATGTCATCGACGCGCGTTGCGTTGCGGAGCT
CGTTGACCTTGGCTATAACGTGGTCGGTGAGGTTCTTGAGTTGATACCCGCATGTCGAGTTGGAATCGATGAGGTCCTGGAGCGTGTCCACGCTCGTGCC
AGCCGTGGAGTTGGTGGCACTTGAGTTTGTGAGGAGGGCCAAGACGTTGACTGCAGACGAAAGGATCTGGTCGCCGTTCGTGACCGCCTGCTTTATGATA
GTCTGGACAATTCCCAGCACGGTGTTCGAAAACTTTGCACTTGCGGGGACTGGGATGCCAAGGCAGTTGCACACAGCAATGGGGAGGTCGAAAAGCACCA
CGTTGGACTGGTAGGCGACAGCCAGTATTTCTTCGACGTCGCCCGCGGGTGCCGTCGTCTGTGTAAAGCGCAGGTAATAAACGAGCGACTTCATCACGCC
AATCATGTTCGATGCGCAGAGGAAGCTCTGCTTCGCGCTCTTGTACTGGGAAAATAACGCGTTGAACACACCGGCTGTCGCAGAGTTAAACGCCGCTGCT
GCAACTGAAGCGGCCTTGGTGAAAATCTCCAGCGAGCAGTCATCGTTTTGAGGAATGCATTCGAAATAGCAAAAGACGGGATATGACATCGGGCACTGCG
TTATGCAGTTGTCAGAGTCTTTGGCGTAGCCCAGCGGACAAACATCTTTGCTGTCGAAGGGCTCCGTCTTCCTGTAGCAAGCTGAGTCGCTGGCATCTCC
AATCATGGGACCCAACCAGTTC