Description :
From Genome Similarity Track
Location :
contig_8:45564- 47380
Sequence
1816 bases(100 bases per row)
TTCCGGCGTGGGATTTCGAGATGATGGTGCTGGAGAGCAAGCGACACGTCGAGGAACGAGCCGAAGCATTTTCCAACGCTACACGCAGCATTGCTTTTTA
TGCGCCCGAGATGGATGAGGACGCGGCTGAGAGCTTCTGGGTGCACATGGTGGAGGAGAGATGTCAACGTCGCCGGGCGTGAAGGAGGCGGTGAGAATGC
ACAGCACTGTCGAGAATGTCGGGCAACGCATGCCCAAAGAGGACTTGTTGTAATTCCTCTCAGCCGCAAAATACTCCACCAGCACAGCGGCATGGATCTT
GGCCAGAGACAGCGTCGTGCATATCCCAATCATTACAGCAACATGAGCTTCATACTTCAAGTAGAATATTTGCACGACATGTTGGTATTGCAGCTGAAGA
ATTGGTACATTGGCAGCTTCCGATATGACAGGGCTGAGGAGGAGAAGTAGGATTGAGGCGCAGTGGGGCTGCGGCGTCGAGTCTGGCATTGCAGAGATTG
CGACGATGCAAAAGGTAGATGACGCAGCAGCAGCGGGGATCAATGGCCAAGGCATGGTCATCAACTCCTCTTGGCGTTTTGATACACATGTCACTAATGG
TGCCTCGAATGAATGACATAGGTCCCGTTTAATAAACACACCTCTTTCGTTTAATATCCTGATATTTTCTGATCAATTATAAAAATAATTCAGTACAAAT
CCTCTTGCTTATCTTTAATCCCTCCGAAATCGATTCGGTGCCGACCCTGCGCTTATTGAGAGGGACCTCTGTATCGCGAGTTTAGTTGCCCTGGTACAAG
TAACATCTGCAGGCATCTTCGTGTTTGTTGCTTGGTCCATGGCGCAATGGTTGGCTCCATGCTGATATCAATTGACCTTCGTGTTTGGAAACAAAGGTAA
CTGGTGCGAGAACGAATGCTATGCTGGTTGTCGACGTCAAAATTCGTATCAACTGATCTCGCAGCAACGAAAGCAGCAGCGTATCCTTGGGCCAAGGACC
TTGGTGACGTTAAGGCCCAGCATGGAGTGTGGGGTGTACTAATCTAGAAGACACCTGCTGGTAAAGTTCAATCTGCCAAGTAGAAACTAGGGCATTGAAG
TTCATTTCATTTTTAGGCTCGATCGACAACATCGACATCAACCGAACAATGCTGATGCTGTTGCTGCTCAATGAGAATAGGCAATGTTCTGAGCATTGCT
CATGTAGTGGCCTCAGCGTGCGCCTTGCTTGCTACAGTGTGCTCTAAACCAGCTTGCCCCGATTGGAAGCTTCGTTTCCGAAAACTTGCCAAAGCTGGCA
CTTTCCTCAGTTGTTGGTGTTCGTGTTTACAGATGAGGCTGGCGTAATTGAGTAATGCATGCTAGTGAAGTAAACTAGCTGCGTGCGTGACAGCTTCGGG
AGCTGATCCGGCCCCAACGAGAGCAACTTCACCAGAATCACATGGAGAGATCATGTACCAGCAGTCGTTGAATGAGGCTCATGTAGCTTACATTAAGTGC
TTACTTCCTCACGCTCTGCAAGTCTCTGGGGCTGAGCAACGCTCTGCTTCCTCGCCTGGTTCTACTTGCAGATGTCAAGCCGCCGAACGCCAGCGAAGGT
TGTCGACGTTTGCTCTTCCTGCACTTCGAGGTCGGCCGATTATTATCTCGCTAATCGCAGCCGTAAAACAATCATCTGCAGCAGAATGCAGATGGCAGAT
CTTCGCCAGCATAATAAACAGTTAGGCTCCGTGGAGGACGGAGCTTCGAGGACGGAGCTTCGAGTTGCCTGCACGTCGCCGGTCCTGGTCCTGGCCCTCC
GCTCCGCTGTAGCAGC