Description :
From Genome Similarity Track
Location :
Scaffold_684:4556- 6250
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_684-fgenesh-gene-0.0Phosphatidylinositol-4-phosphate binding protein

Sequence
1694 bases(100 bases per row)
CTGGCCGAACCTGACTCAATCCGTGTGGTCGCAGCGCGACGGCGCGCAAGAAGCACACCAAGCTGTACCCTTTGCCGGAGGGCTTCTTCCCGGAGGTGCG
ACTCACGGACGAGCAGGTGAACGAGTACGAGGACCGCATGGAGGAGATCGTCAAGGCCGCGCTGGACGAGTACGCGCAGCACGAGAACAAGGGTCCGTAC
CCGGTGTACCGGCCGCCGTGGTCGCTCGTGGGCACCGTCGACACGCTCACGACGATCCGCAAGGAGGACCCGGTGAACCCGACGCCGAGCCGCGCGCGCA
TCTTCGGCCGCATCAACGGCGACTACCGGCACTTTGTCGACTTCTTCTACGCCGAGACGTCCCGCCAGCTCTTCGAGTGGAACAAGTTCATGTTCGGCTA
CGTCGTCGACACGCACGTGCTGCGCAACATCCACACGCAGGCGTCGGGGCGGCCGCACCTGTACATGGGCATCAAGTGGACGTGTCTGCAGCCATCGACG
CTCGTGCAGCGCCGCGACAACGTCTACATGGAGTACCTCACGTACGCCAAGGACAGCAAGGGCCGGGACGTGGGCGTGCGCGTCACGCTGCCGCTGGAAA
TCCCCGAGTGTCCGCCGATGGCCCCCAAGTTCAAGACCAAGCGCATCCGCCTCTACACGGTCTGGATCTCGCGCGCCGTGCCCAACGAGCCGTTTTCGAC
CGACTTCTTCATGCTCTCCGAGAACGACTTCAACGGGCTGGCCGTCACGGGCCGCTACTACAAGAAGATGATGCGTATCCTCAGGGACATGGCCGTCTTC
GTCGACTCGCGCCGCATCGTCGTGCAGGGCATGGTGACGCGCAGCCAGTGGGTTCCCGGCGAGAACCGCAAGAACTGCAAGCTCTGCTCGCGCCGGTTCC
ACGCGGCGCGGCGCCGTCACCACTGTCGGCTCTGCGGCGAGGTCATCTGCCGGCGGTGCATCATCGTGCGGGACGCTCCCAAGGGCGAGCGCTCGCAGAC
CGACAAGACGTTCAAGGTCACCAAGACCAAGTTTTGCATGTTGTGCGTCACCAAGATGCGCGAGGCCGAGTCGAGCGTGCTGCTTCCGGGTCTGACAGCG
TCCCAGGCGTCCAGCGCCGACGTCGGCGAGAGCAGGAACAGCAAGGCCGACCGCTCGCAGTACTCTCACTCGGACTGGGAGTACGACTCGCGCAACTCGA
CGTGGTCCGAGACCGAGTCGGAGGACGGGAAGCGCTCCATGTACTCGAACTCGGACATGCAAGAGCGGCGCTCGTCGCTGTCCGAGTGCTCCGAGACGTC
GGAGGACAAGATGTCGTTCGTGGCGACGCTCGAGGTCATCAAGGACGAGCCGGTCGACAAGGGAATCGTGCTGCGCAGCGAGCAGGCGCCGGCGCAGGCG
AGCCTCGAGCCCGCGAACGAGGTGACCGAGATCATCGACACGACCGAGATGTTGCCTATGTCGCGCGCTTCGCAGCGCAGCGCCTCGCGGATGTCGAATG
TGTCGTCGTCGGGCGGGCGACCCAGCGCCGCCTTCAGCGACGATCACGACTTCGACTTCTTCGGCGGCCAGCGCGCATCCTATGCGCACAGTGTGCGGTC
GACCGGTAGCACACCCGTCTCGCCACGCACGCTCGACCAGAGCCTCGCTGAGCAGGAGGAGCTTCTGCGTAGGATGCTGGTTGCGAGCGGCCGC