Description :
From Genome Similarity Track
Location :
Scaffold_12:455597- 460925
Sequence
5328 bases(100 bases per row)
AAACGACAATGTCTATGGAAATTTGGTCGTGTGTAGTGAGTAGTTAGATGACGTGAAGGTGTAATGGTTTGGAATGTACATCTTATTACTGCAGAGGTTT
ATTATAACAGGCAAATTGCGATGTGGTAGTCAATTACCATATTGCAGTGGGAAATAAAAAATCCTAGACGCATTCAAGTCAATATAACGCCGGCCCAATG
GAAACTCTTCGCACATACGAACGACCCCATGAGGAGCCGGACAGAATATTACATGTATCCGACTATTACTTTTAAATTTTGCGAAAAAAATGGTGGGGAA
TATTGTGTTACGCTCTGGAAATTTTAAGGACAATGTTGATGGATACTAAGGACCACACAATACCTGATTGCCTTGTTCAGGCAAACCACTTGCCTATTTT
GCTCAAGCGTATGAATTGCAACTAGATGAGACATAGCCATTGGATGTAAATTTGTAAGGTCTGCCTTGGAGAAGAAATAGAAGTAAGTGCGCCGTCACCA
TTTTTGTAAGGAGTTCGGCCATATCCACCAACCGCGTCCGAAGCGAAAACGCTCGTGTCGGGCCCACTCGACATTTTTTGGTGGCGGCGACTGAAGTGCC
TGGTATTTATCGTAATGTTTGAATTTTGGATACAAGTTTTAGCTAATGTTTGGTGAGCGATGATTCGTGAATTCACAAAGATGAACCGTGCTATGGAGTT
TTCCGTTCGCCTGAAAATGTCATTGAACTTACAATTAACGCTGTAGCTTGTAAATATGAAGGTGTGTTGATGCTAACGAAAGTCTTTTAATGTGGAAAAT
GTCAAACACAATGTAATTCGTATGGGCTTTTAGACAAGAAAGGCCTTACTTGGGTACAGTGGTAATAAGTCGTGTTAGCATTCAAACGTTCTGTAGATGT
CGCTTTCAATTTTAATTATATGAAAATGTTCTTGTGGTTCTGTGTCGAATAGTAAAGAGCATTGTGGGGCCTATCAAAGTCATCATGTCAATTTAGATGA
GGAAGCGGTCAGGGAAGGATCCGATAGTGTTCATTATGGCGATTTGATGGAATGCGCAAGTGCTCTGAAACCTCATCTACAAAAAAGTTAACATACAACC
TCTCATCTAATATTTTTCTCACGGGAAAACGTCGAGTCAATTGTCGGACTTGTGCGCAGGATAAATAGACCAAGAGCCGATTTTCAATCAAGAATGCAGT
ACAATACCCACCCATTAATAAAGCTAGAGGATTCATTTTTATAAAAGGACTAAAATTTTTGACACCGAAAGAACTTCAAAAGAACCGCTATATGATTTAT
TTGGTTGATCACAAAAGCAACTAGTGTCGTGTGTTCCTTGCACGTACCAGAGATACTTCGGCCAAGCACTTTTAGCATTTTCTGGCATTTTCAGAAGACG
TTTACAGGTCATGTACCCCGGCTTCATACGGGCCTAAGAAGAAAGGATCACAATGTTGATTATTCTGCGAGAAGACTGTTGCACCAAGACAATAAAAAAG
CGATCAATCAAGTAAGCAATGAAAAAGCCGAGCGAATGCATTGAAACATAATGGATATGGCTTGTCGCATGATCGGCTAGTGTCTTACCATTTAAGCTTT
AAGGTGGTGCGTTGAAGTATGCTGCGTACATACTGACGGCTTCAACAACTTTGAATATTTGTATGGCATCACCTATCAAGTTGTTGATGGGTCAGACACA
GTACCTCGGTGAGATCTTCGTTTGAGGCCGCCATACACAGTGTACAGAAATACCAAAAAACAAAACGTGTACAGAGAGGAGATAAAATACGTTATCGTTG
GCATTGGTATAGAAACCTAAGGGAATCATGTTTACCTGCCAACTAAAAAAGAGTGGTCGATATCACCCAACATGTGAAGAATATTGAGACGTTGTCCAAT
ACCCACAACAAACAAGTTCAGGATTTTGTATTTGCACATTAATGTTGGTCCAAAAAATAAGAGGTCCGTGCGAGATGAAATCCAGTGGCGATACACCAAT
ATATCATGGAAAGGGGGAGAAGAAGAAATTATTCGGAACATATTCCAAGAACTACGTAGACGAAATAGAAGGAGGTTGAGACAAGGTAGGCGAACAAAGA
TAAGCGGGTAAGCAATAGACACGGATCCAAGGTACCAATCATGAATTATGATGTTGTCAATGTTGATTCAATTTCTGAAACTATCATGGGGCTATGCCTA
GCAGTCATATCAAAGAGGATATCAAAATCATAAGTGTTGGAGGCTTGGAGACCAATGAAGTTTGGAACGTTGTGGATGCTTCAGCGAATATTCAGGCTTG
AATTCGAAGGGTTACGATACGACCACGCTTGGTGCATAAGGCGGTGGTGAGCTTTAGGGGAGAGATAGGTCGTTCGTAGAAACGAACAAGTTTCGGCGGT
ATATACGGAACAGTTTGAGCGGCTTAATTTGCATGTCGGATGTGACGACTACTTTTACATTGGCAAGAAAATGGTGGTGCTCCGAAGTACGAAGACATTC
CTAACACTTACTAAAAGCAGAAAAAGAACCGAATCTAGATATTTACATTCGAGTCCCGCATGGGATGCAGATCTAAGAAAAAATATTAATTAGTTGAATA
TTTCGATGAGTAAATATTTGTTGAAACTGAAGACAACGCTCTATGGGCTGAACCAAGCATGAAGGCTGTGAAGTAAATTGCCTTACCTGAAGTCGATCGA
CCTTGGTGTTACTAAAGCCTTACCGATATGTGTGCTGATATTAGATGGAAAGTTGATATATTTTGACTTGGAGTTTGGGCACAAAAATAAGCTAAGGCTC
GGTGAATACATTCTTTGACAAGCTCATTTCGCTTTTAGTGAAGGAACTAGAAATTTCTTGAAAGATTTCGGGTATGTGTATCCAATGGGAGAACGAGGAT
GGCTACAGCTTTATTAAACTACGTAATTGGGTGTACGTACACCATGCTCTAAATCAAGCCTTACCACTGTGGCCATGTTAAAGGGGCATGGACTTGAATT
GGAGCATGGCGTACATACACCCATTGCCTAAGACTAGAACAAAGCTGAATACATTTAATTCGAGACTCTATGGGTTGCTGTAGGAGATGGATTGATAACT
GTGAAATCATTAGTCACGTGTGAGAAGTTTACTATGGATTACTTGGACACAGAACTGATGTAGCATTTGCTGTACATAAGGCGTCAATACTAACTCACCA
GCCAAAAATGGAAGACTGATAACTGGCTAAGAAATTTGCCAGGTATCTTTCTGGTGCGTAAATTCGTATCTTTCTATAGTTGGTAGAAGATATAATTCAG
GTTTGATTTGCAAGTAGATGGATTATGTAACTGGGCACTGGTGACTTGTACTGACGCAGTACAAATTAACTTACACTGACGTAGTGTAAGTAGTGCCGCA
CGTCACTTCACGTACACCGTACGTGCAGAGGAAGGTTAGCTATTGAACGACGCGGTCAATAGAAGTAGAAGGTATAACTTTTTTAAATATAATTAAGTCC
TAATCATTATCCTATGTCTTAGTCCGAACTTAATTATACTTACCTACCACATTGTATGCTGAGCTCTTGCTCACCACTCATTGCGCGCGTCAATCACTGA
TTAGACCGCTTGAGCTGACTGATATGATGGCCCATATCAGCCAATAAGTGAGTGCTTCTGAATATTATTCCTTATGGTGATATTCATGAACATTATCAAC
CTTCATAATAATATTCTAATGAACAACTATTGATTGTCAGGTAAATGTAACAGGCTCGCCCCGCTACATCAACTCTCCTTAAAAGATAGTTAATCAATAA
CTACCATGTTTGATGTAGTCACCGTTCGACTATTTCAGGGAAAGGGAGCACTTGTTGGCCATGTCCACTCATTTCAGAGTTTACCAGCATGGCGAAGGAC
CCCAAGCGAATCGCTGCAAGACCACCGAGAAAGCAGCTGCGCGTGTGAGCTCAGCTGCTCGTGACATTTCACAGCCTCGTGCTGCAGACGATGTTTCGTC
TGCTGCTTCTTCAACTCTTCCTGCGGCACCAGTTGCTGCAGATGCACGTGGTGAGTTACCACGTGTTAATGATGATGGCTCATAAGTGGAGCTTATTTAT
TTCGGGGGAGTCGGATGGTGGGTCCGACTCTAAGAAGGCACCTAGGTCTCCCGAGTCGACCGGAACGGCCGAGTATGAGCCTTCGAATAGGACTCGATCA
GGTCGTCTGACTCGTGGTCACTACCGGAGTCTGTTTAGATCGGAGTATGAGCATGCTACCTCATCCCCGCTTGATACTGCGCATTCGCCTTCTAGCGAAT
GCGAAGATAAATTTTGCCATCGTGAGGGCGACTCTAGTGGTACCAAGGCTTCCGTTGGTACCACGCAGGAGGCTATAGTCGGCAATGTGCTGCGTCTATC
CCCAACACAAGCCTTGGGTGTTACCAGAAAGGATTGTGAATGACTTGTCAGGCGAGACAAGTCTCCATCATCGAATTACATACTTCGATGCGAGGCTGTT
GCACGGCCTAGACATCAGTGCGACCAACTTTCGCGCTAAAGAAGACTTCTATCTGGATGCTTTTCTAATGCATCACAGGTATGGTGGCAACACTTAGAGA
GACAAAAGCTCGTTAGGGCTGGCGTGGAACGCCTTTGTGCTCAATGTGCAGCACATTGGGCGCGAGGCTTGGCTTCAAAAACTTAAGGCAGCTCGTGTTA
GGTTTGAGAAGCGAACCTTAACGGGTGCAAAATTGAGATTGCATCAATTGTCTCATGGAATTCGTGCCTCACGTGGGGCGACCCATGTCCGTGTTGTTTC
GATAACTCGCAGAGCGTCCAAAGGGAGGTGTACTCCCTTTATTTGCCCTGGGGAAGGGCGCGCATCTCTACTGTCTACGGTATCAACCTAAGCACGTAGT
AACTAATGTGGATAGTAGTAAACTACTACCCAAGTACATCGGCCCGTTTCGTGTACTACATCGCAAAATCAATGCGGACACGATAGAGTTGCCTCGCAGG
ATGCGTATGCATCCTACGTTTTATGTCGGTCGTCTCCGCCCGTACCATCAGCAAGTGGTTTCTTCCTCAGAAAAATACAGTCGCCACGCTCAAGAACCTC
TTGACGTTTCTTTTGGTCCCGAGCCATTTTATCAATCTGGCTCTGGAACGTCACCATCTGGCGGTGAATATCACCGACTTCGTCGCAAATGGCTTGGCTC
CCCCAACTGTTCTCCAATTGGGAGAACGCAAACTCCGATCGGTCTTACAATCGATGAAGGCGGTAGCGTTGTACAGACACCTCCACAGATAGCCGTTCTT
GCCTCTCTTATTCCACAAGATCACGCAG