Description :
From Genome Similarity Track
Location :
Scaffold_12:455235- 479780
Transcript NameFunction/comments
Phyra_75394protein kinase, putative
Phyra_75395Hypothetical protein
Phyra_71305Translation elongation factor Tu putative
Phyra_75397abc transporter
Phyra_75398abc transporter
Phyra_75399ABC transporter-like protein
Phyra_75400ABCG transporter ABC superfamily
Phyra_75401betacateninlike protein putative
Phyra_75402protein kinase, putative

Sequence
24545 bases(100 bases per row)
TGTCCTCACGTTGGTAAGTGTGCCGGTAGAGCACTACATTAAGACAACTTACTACTCACACACGGTAGTCTAACCAATGAGTCATCATGGTCTCAGATTA
GTGTTGAACCAAGTAGAAAGTCAGGGAATACGCGTACATGAAACTACGTGCATCATCGTTTAGTGAGTCCCTTGTCTGCTTCTTCGTGTTACCCTTAGAA
ATCAAGTCTCTCTTGTATCGTCCTCAGCATTCCTCTTCAAGTCGAGTCAAGTGTACTGCAAGGCCGGCAGTGGCAGTCTACGACGCGGCCACCGACGCGG
CCATGGCGGCCTTGGCGGACGCTGCAGCGCTGCTGGTCGCACGCGACTCGGAGATCGAGCTCTGGTACGTGCGGAAGGCGTTGACGATGTGCGGGAAGCT
GGGTCGCAGCTCCGGCTGGCGGTTCCAGCAGGCCTTCATGAGTCGCGAGAAGAAGGGCGGACACTCTCGCGGGATGTTCGGCCGCAAGTTGCGGTTCAGC
ACGCCGAGCGCCGCCTGGATCTGGCTCATGCCGTCGTACGGACACTCGCCCGTGACGATCTCCCAGATGACGATCCCGAACGAGAAGACGTCGGCCTTCT
CCGTGTACTTCTGGTTGCCCAGCACCTCGGGCGCCATCCACTGGACCGTGCCGCAGTTGCCCGTCATGGTCTGCACGTGAGCCTTGACGCGGGCCAGGCC
AAAGTCCGACAACTTAATGTTAAAGTTTTTGTCCACCAACAAGTTGGGGCTCTTGAGGTCTCGGTGCAGAATCGGCCGCTCAAAGTGGTGCAGGTACGAC
ATGCCCTTGGCCGTGTCGTAGATGAACCTGGAGCGCATCTCCTGGTCGATGGACTTGCGGTTCATCCGGAGCACGCCCCAGAGCGACCCGCGCTGCAGCA
GCTCCACCACGAGCGCTCGGTGGGGCGGGTCCATGCACGCGCCCAGCAACCTGCAAATGTTAGGGTGGCGCAGCACGCTCATGATCTCGACCTCGGACTG
GAACTCGTTCAGGATGTCGCTGCGCAGGTCCTGGCAGATGAGCAGCTTGACGGCCACGCTCTTGCCGCGCCATTTGCCCTGGTGCACTTTGCCAAACGCT
CCTTCCCCGATCATGCGACCTAGAGTGATCTCATTGAAGTTGATGTTCTGACTGTAGCTGGTGGCCCGGTGTTTCACGGCCGACTTGTCCTTGGCCGCGT
CCACCGGAGCCGGCGGCGGTTTGGCCGCGACGGCGGCCACGTCTGCCACCTGCTTGGTCGCCTTGGCCCGCGCTTCCTCTGCACTGATTATGGTGGCGTC
GGTCTTGGCCGACTCGGCGTCGCTATTGTCCGTGTCGTTCGTGGCTTTGGTGTCGTGGCCGGCATTGAACCAGGCCGAGAGGAAGTGCGGGATCTTGGCC
TTTTTGGCTCCGTCCAGCTTGAGCTGCTGCACGGGCTCCATGGTCTGGCCCAGGAACTCGGTCGAGTTGCGGCGGCCGCGGTTCTTGCGGCCGGCGTCGT
TGCGCACCGTGGCCACGCCGGCCTCGTCCTCTTTGGGTTCGGGCTGCTCGGCCGGCGGCGTGGCCCGCTCAGCCCGCTGTTTGGCCTTCTGCTGGCGGCG
CAGCTCCTCTCTGAAGGCCGCCTTCTGGTTGATGTCGAGCGTGGCGGCCTCCGAGTCCACGGGCGCGTCCGGCGTGGGCCGAGGCGGCAGTTTTGGCACG
CGACGGGCCCCGGCCGCGCGCCGTGGGCTGGCCCCATTTTGATGGGCGAGCCCACCGTGCCGAAGAAGGTGCTCGTGCGCGTGGGCGCCGCATTGGGGTC
GATCTGCAGCGCGCTGGGCTTCTTGCGGCGGTGGAACGTGAGCTTGCGCTGGTTGCCGCGCACCTTGGCGTTCTCCTTGTTCATGGCCTTTGGATTGAGC
GGCCAAGCGAGAAGTGGCCGCGAACCGCCGCAGCAACCCGCGCCCCCTCGCTCTCTTCCTCACATTCTGAACTCTCTGCCTCTGCCGCAAGCGACAACCC
AAAACAAACCACAGCCATCTGCAATTACTCACCTTCACTATTTGAATGTTGCAGCTATCTTGGCGTTCCCATCACTCGGTGGGCCGAGAATCTTTGCCAG
CTTCAGTCGAATGCAAGAGAGGCCCATGGCCCATGGCGTCTCTGGCGTTGAAGCTGGCGCTCCAGCGCTTCAACTCGGCGATCGACCAGAGACCGCGGTG
GTCGACAGATGGATATGCGATGCCAAGCCTCACAACGCCGAGATGCAAGCCACAAAGGCGCGAGAGACTCCGTTCGTCCACAGTGAAAGCATCCTTCCGC
TTGCACTCGCGTTATCGGAGCTCCTCGACGCTCTTGCAGTCATCCCACGCTGCCAGACCGCCTGCAACTTGCCAAGGTTGCAGAGCGGTCGGCTGTTGTC
CTTCACTGGTCGACGAGGAGGACATGTGGAGGACACATTGGTTGAAGTTGAGTAGCCGAAAATTCGAGAACAATTTTTTTTCCGGCTCAGTTTTTGTTTA
TGGGAAACAGATAGCTACACTTCCCTCTTGGCGGACCAAAGCCTCGATCCTTCCTCTCGGTTGGTGGTGATGACCCTCTCGCGAGCAACAACACGATGTG
AACTCTTTTTCTGCAATCGTTAGCGCCGCAGATACGCGCGAGGCGCCTGGCTGCATCAAACACTTGAGCCACCTGTGAAAAGCGCAACTTGCGGCAACTA
GCTGCTTTCGAAGCAGGCATCGCTTGATACGATGACGATTCCGACACATGCACACGGCAGTCCGAAACTTGTCTCCGGTCTCTTCGGGGTTCTGCTCGCT
CTCTCAGATTTGCCTTTGCACTTGCTGACTCGCTGAGTCTCGAATTGAGAACCCTTTGCCCCTCGTCGTCCTGTCGCCGCTGCCATAGACCGGGGCCCGA
CGGAACAGGATGGAGATGCAGAAGCGAGTGTGCGGGATTTGAGGGGGCACTGGTGGCCGCCGAGTCTAGCGTTGCACAGCCACGAAAGTCCTCACTTTGC
AGTTGTGAGACTTTGGACAGAATGGACCCGGGCAGCTCGACGCTAGGGGGGATCCCCAAGCTGCAGTTCTCCAAGGAGCGCCGCCAGCAGCTCGAGGCCA
CGAGCGACGACCTCGTGGACAAGGCGCTCCATGTGTACGACCAGTTCCACACCAACAAGAAGCACGTCTGGACGTCCAAGCACTGGAAGCTCGTCAAGCG
CAAAAAGTCGCTCAACATTTACAGGGAACGCGGCAAGTCCAAGACGCAGGACTGCCGCGTCTACCTCTGCAGCGGCGTCATGCCCGGCACAGTCGAGGAC
ATGCTCAGTGGCACGTACTCCGACGACACGGAGAGCATGCGGATCAGTCTCGGCATCACGACCGACAAGTTCCTGGACGCGCGCGTACTCCACGTGTTCG
AGAAGAACCCGGCCACGAGTAGCGTCGTCTTCTCGGGCATCAAGTGGATGGCGCTCAAGACGCCCACGACCGCCTCGCTGATCCACGACCGCGATATGCT
CATGTACCACCGCATCGGCCGCATTGTTGATCGTCAGGGGCGGTACTTCGTCTACTGCGTCACGGACTCGATCGACCTGGACGAGTTCCCGGCCAACGGA
CAGGCAAACTTGGAGCGCGCGACCATCTCGATGTGCTACTTGTTCCGACAGGTGCAGGAAGAATGGGTCGGCTGCTTCATCATGGGGAGCGCCTCCATGG
GCGGCACTTTGCCGCGCAGCGTGAGCGAGCTCATCACGGCCGAGCGGATGCTGTCTGTAGGGAACCTCCTTGTTGTAGCGCGCGCCAAGGCGTATTCGGC
CCGCCTGGCAAGCAGCGCTGAGCGCATCCCGTCCACAAGTAGCTCCTGTGACGTGTGCATGAAGAAGCCCAGTATGCTGAGCGGCTCGCTGAAATTGTGC
ATGGGCTGTCGTCGCAACACGTGCAGGAAGTGCCGCGAATCGTGCACCGTGTTCCGCCTCGAGCTTCGTACGCACAAGTCGGGCAAGGAGGTTTTCTGCT
CGCAGTGTATCTCGGAGGTCACGCGGCCAACCATGTCAAATTTCTACATGTGCAGCCTCAACGAGTCGTCGAGCACCCAGCAGCAGAACTTCCAGAGCTC
GAGCTCCGTGTCGTCCGGCTTTAAGCACAGCAGCAGCAGCCCGTCGTCGTCGCCGAACTCGCACGATTTCTCCGAGAGCGACTCGGACGCGTGGCTGCCG
GCGCCGCCCGACTTCCCGGAGAACATGGAGGGCTTCGCCACGTTTGTGGGGCGAGCGAGCGTCGCGAACTCCAAGGAGCTGCAGTGGAACCAGGAAGAGC
TCGACTACTTCTCCGGCATTTTGCGGGAGACCGGCCACCTCAACCCGCCGCAGTTTTCAGAGAACAGCGACTCGGCCGGCAGCAGCAACTCGCGACGAAC
GAATAGCTACACGAAAGGTTTCAACCCGGGCGGCTCGATGCCTCCTCCAAGTCAGGACAAACCCGATCGCCAGTTTTCGAGGAGCTACACTACCGATGAC
ACCTCAGCACCACGGGATCAGAAATTCTTTAGCGTCGACGAGCTTGACTAAATGAGACGTCAGAGGACAGTTATTGGAAATATAGACAGCAACGGCATAA
CATTGGATGTATGAAGCTTTGAAATCATGGCACAAGAATCAAACGTTGACGCGGCACTGCGTGTTAGTGATTGTATGTATTGTTGGTATACGAAGCTCGA
CACGACGCCGACGTCTGCTTCGCTCCCACGCATCTACTGCAGTCGTTCTGCAGAAAATATCTACGACTCGACCTTGGACACGACGCCAGCGCCGATGGTG
CGGCCGCCCTCGCGGATGCTGAACTTCATGCCGTTGTCCAGCGCGATGGGGTGGATGAGCTCAATGTCGATGGCCGTGTTGTCGCCAGGCATGACCATCT
CCGTGCCGGCCTTGAGCTGGATGTCGCCCGTCACGTCGGCGGTACGGAAGAAGAACTGCGGCCGGTAGTTGCTGAAGAACGGCGTGTGGCGGCCACCCTC
CTCCTTCTTGAGCACGTACACCTCAGCCTCGAACTTGGTGTGCGGGTTGATGGTGCCGGGCTTGCACAGCACCTGGCCACGCAGCACCTCGTCACGCTTG
AGGCCGCGCAGCAGCAGGCCGACGTTGTCGCCGGCCTGGCCGCGGTCCAGCGACTTCTTGAACATCTCGACGCCCGTGCACGTGGTCTTGGAGCTAGCCT
TGAGGCCCACGAGCTCCACCTCGTCGCCGGTGTTAATCACGCCCTGCTCGACGCGGCCCGACACGACGGTACCACGGCCCGAGATGGAGAACACGTCCTC
CACGGGCATGAGGAAGGGCTTCTCGAAGTCACGGACCGGGTCCGGGATGTAAGCGTCCACCTCGTCCATGAGCTTAAGGACGGCGTCGCGGCCAATGGTA
TGGTCGCGGCCTTCCACGGCAGCCAGGGCCGAGCCCTGCACGACGGGGATGTCGTCGGCCGGGAAGTCGTAGGCCTCGAGCAGCTCGCGGATCTCCATCT
CCACGAGCTCCAGCAGCTCCTCGTCGTCCACCTGGTCCACCTTGTTCATGAAGACCACGAGGGCCGGCACGCCCACCTGGCGGGCCAGCAGAATGTGCTC
GCGGGTCTGCGGCATCGGGCCGTCGCCGGCCGAGACCACGAGGATGCCGCCGTCCATCTGGGCCGCGCCCGTGATCATGTTCTTGACGTAGTCGGCGTGG
CCCGGGCAGTCCACGTGCGCGTAGTGGCGCTTGTCCGTCTCGTACTCTACGTGGGCCGTGGAGATGGTGATACCACGCGCGCGCTCCTCGGGAGCCTTGT
CAATGTCGGCGTAGCTCGTGAACTCGGCGCCGCCAGTCTCGGACAGCACCTTGGTGATGGCGGCCGTGAGCGTCGTCTTGCCGTGGTCCACGTGCCCGAT
CGTGCCTACGTTCAGGTGGGGCTTGGTGCGGTCGAACGTGGCCATGGAGCGCGTGGCCGCACGGCGGCCCGTCGTGGCCAGGAGCTTGCGGAGGAACACC
ATGATCTGAGGAGGAGAGGGGCTCTTTGTGACTGGCTGCGGATTGTTGAGCGGAGTCGGAGGATAGAACGGATGGCATGTGATTTTTTACCAAAGAAATA
TATATGAATGGGGAGGGGTGTTTCAAATCGACTTTTGACCTATCCGGTGCATAGATCACGCCGACGAATTGTGGCCGCTCGTTTGGTGGTGCACTATCAG
AGTATCTGCAGTGCTGCATGGCGGTGGCGGTGGCGATGGCGGTGAGCGTCTAGACCTGGTACCAAGCTGTGGGGGTTGAAGACAGCAGCGTTTGCAAGGG
GCTTCTCAGAACTACTGAGCCAGCCGGCTGCAAAGGCGTCCACTTATACTGTTACGTCCAATGCTAATGGCACCTGGACTACCGGCATTGTGCTCCTAAC
GTTAGCCCTGTAAAGACAAGAACCTGCCGCTCAATCTCTCCTCGAGGCCTCAAGTGGGCCGTTAAGTCGATGGTGCAGTATGAAGGAATAGCAAAGCATA
TGAACGTGGATCAACCTGCATTACCACAATTTGTGAGCGCCACAAACAAAACCCAGATGTGGTTATAACCTGCCATTTCACGAAAGAATTGCGCTACATG
CACAGAGCAAACAGCAGCCCGCTGCTGCAGTCATTCTCAGATCTTCACTGAGGTTCTCATTACACGTTGACACACTTTCATTATCTTACTTACATTTAGT
TGGCTGTCGGCACCGCTTGCTCACCGGCGGCCTGTGTGGAACTTCCATAGGATAAACATGAAAATGATCTGGAAGCCCACGATGTAGGCTGCAAGATACA
GCATGTCCTGCATGACGTCCACGTCCTCCATGCCGTACTTGACCAGAATGGCCTTCGCAGCGTCCGACGTCTCGTTCTCGAACTGCTTGAACACGAAAGA
CTCGAACGAGTACGAGTGGAACGCCAGGTAGTAGCCCCAGATCCAGTAGTCCGGGATGGAGGCGCGAGGCACCATGAAGCCCTCGCACAGCATGAACATG
CCGAACACGCCCGCACCCAACGCGATGCCGATGATGTAGTGCGGCACCGCAGACCCGATCACGTGCATCATGGACTCGGACACGACGAGCGACAGGAAGA
GGTTGAGCAGGAAGTACTCGAACGCGTTCAGTCCCGCCAGCAGCACCACCAGCGCCGTCGACATGACCGCGATCACGAAGATGCCCGGCAGCGTCGCCAG
GAAGTTGGCGCACACGTAGCTCACGACGCTCAGCGAGCTGTTGGCGCGCTCGCGAGCGAACACGGCGCGCTGCTCGATGAAGAAGGGCAGCACGGCCACC
GACATGAACACCAGGAACGCCTGCACGTAGAACAGCAGCGGCACCAGGTCCTCCTCCGTCAGCTCGTTGTTCGTGCTCAGGTACATGGTCCCCACCATGA
AGCTCAGGCAGAAGTACATGAAGAGGCGGATCCAGTAGATGCCCGGGTTGCGGATGTTGTTGAGCGTGTTGCGGTACATGAGCACCTTGAACTGCCGCAG
AGACGAGGGCGACGGCTGCTCGATGTCCGGCAGGTGCTGCAGCGTCTTGCGGTCGCTCTCGATGCGCGTGCTCAGCTCCTTGCGGGTCTCGCTCTGGGCG
TAGGCCTGCACGAGCTTGGGCACGTCCGCGTGGTCGTCGAAGTCCGTGTTCACGAGGCTGATGAAGTACTCGGCCGGGTTCATGTAGTTAGGACAATCGT
AGCCGGACGACGCAAAGTGCGGGATCATGTGGCTCGAGGGCCGCAGTAGACGGTCTGGCCGGCCGACAGCACCACGACGTTGGTGAACATGTCGTAGACC
AGCGACGAAGGCTGGTGGATGGTGCACACGACGGTTTTGCCCTCGGCGCAGAGCTTGACGATGAACTTCATGACGTTGTGCGTGGCGCTCGAGTCCAGGC
CGCTCGTGGGCTCATCCAGGATGAGGATGCTCGGGTTCGACAGCAGCTCGATGGCGATGCTAAGACGGCGCTTCTGGCCGCCCGAGAGGCCCTTGCGGAA
GATGTCGCCCACGAGTGTGTGGCGGCACGTGGCCAGCCCCATGGCCTCCACCACGTCGTCCACGCGGGCCTCGATCTGCCTCGTCGAGACGCTCGTGGGC
AGACTGAGCTTGGCGGCCATGCGCATGGTCTCGAGCACCGTGAAGGACCCGAGCAGCGAGTCCTCCTGGGCCACGTAGCTCGTCACGGCGCGGAACGTCT
TGGTCACGCGGGCCTCACCATTGAGTTCGATGTCGCCCGTCACTTCTCCGGAGCTGATGCGGTCGGCCAGCAGGTCCACGAGTGTGGTTTTGCCCGATCC
GGACGGGCCCATGATGGCCGTGAGTTCTCCAGGCGCGCAGCGGCCGCGGACGTTGTCCAGGATGACCTTCTTGCCTGTAGGAGTCTCAGGTGACTTGGGG
CAGGCCACGAAGTAGCTAAGGTTGTTCCAGCTGAGCACGCTCGGGTTGGTGAGGTGCTGGTAGAACGGCTCTAGCTTCCCACCGATTTCAAGGGATTCCA
GCATGGCGTACGATACGCCTCTTGCTGAACGGGGTGACTCCATGACGAAGGTCATGAAGATGCAGGTTGTTTACTAGTTAATGGCTACTGGGACTTGTGG
CTAATGGTAGAGTTTGGCGAATGGCGGCGACTGCGCTAATGTGATTGTGTTTGCTGGTGCCTGACCATTTCGGGGCGAAGGTATCCAGTAAACATGATCC
TTTGAGCGAGTCTCGTTGCCTGACCGGATAGGCACATCGTGTCAGGCGTAGCGAATCTTTGGTTTACGGCAGGTGCAATATTTCCCTAAGCGGATGTGTC
CGTAGCTCACGGAGGCACGATCGACCTGGATGCCCGTGGAGACCATAGCTATCGGGCGTTCAATTCTGTATCAATAGCCGATGATACCGCGAGTCGTAAG
AGCTTTGGGCCACTACGTTTTCGTGAGCGTAATGCAGTTAATGCAGTCGGGACTCGACACTTGGTGCCAAGGGCATAAGGTGGACAAGGTCAAGTTGAAG
GCGCTTATTAGCAAAACGCGCCGGCCATCTGATGGGTTGCTGTCGGCTCTGAGCTGCTCCAAGCGAATCTGTAGCGCAAAAGGTGAGGAGGCCCGCCACG
CGTGACTAGCAGGGCAAGCCGCGGCTGCGGGTCAGGCACCACACGGGCATTGTCCGACAAGATAAGCACGCCATGTAGGATACCGTCGTCCAGCTGCAGC
GTCCGTCAAATGGCAGCGGCTCCTCTGGTCACGATTTGCACCCCCTGTCGAGCTCCCCCTCCAACGGCGGCATGCATGATGACCTTTTCGCGCGCTGACG
TCGCAACGCCTGACTCGGGCCCTGGGTCAGGCACACGGCATCCAATCGCACAAAATGACAGGACCCGTATGTTTTCGCGAATTGTGGGCGGTGCCTGACC
CGCGTAGCGTCGTCCTCATCAGCGGCGGCGTTAGTGACGGTACCTCTCGGCCGTGTGTGTCCCTGTTGCAGTCCTGCGGTGTCGAGCCCCCACCTGGAAA
GGCTCGGCCCAGGAGACGGCCCGGGATTTGCACACTTTGCAATTCGCGGCGCCACCTCGACGCAGCCAGCCGGTGTCGTTCACAATCGAACTCGCGCAGT
GGGAACGAGACCGCCTCCGCTCCTCCACCGGCAGCACCGCGCTAAGCTTGTGCTTCTTCGTGTTGGACCCGGACCGAACTCCATCCATCTCTGTCATGGC
GTCGCCGCACTCCACGCCCTACACGGCGCTCGACGCGCTCGAGACGGGAGGCAAGACCGAACCGTCCTACCAGCACCTCACCAACCCGTGCGTGCTCAGC
TGGAACAACCTCAGCTACTCTGTCGCCTGTCGCTCGACGGCCGACGCGCCTGCAGGCAAGAAGGTCATCCTGGACAACGTCCGCGGCCGCTGCGCGCCTG
GAGAACTCACGGCCATCATGGGCCCGTCCGGATCGGGCAAGACCACACTCGTGGACCTGCTGGCCGACCGCATCAGCTCCGGAGAAGTGACGGGCGACAT
CGAACTCAATGGTGAGGCCCGCGTGACCAAGACGTTCCGCGCCGTGACGAGCTACGTGGCCCAGGAGGACTCGCTGCTCGGGTCCTTCACGGTGCTCGAG
ACCATGCGCATGGCCGCCAAGCTCAGTCTGCCCACGAGCGTCTCGACGAGGCAGATCGAGGCCCGCGTGGACGACGTGGTGGAGGCCATGGGGCTGGCCA
CGTGCCGCCACACACTCGTGGGCGACATCTTCCGCAAGGGCCTCTCGGGCGGCCAGAAGCGCCGTCTTAGCATCGCCATCGAGCTGCTGTCGAACCCGAG
CATCCTCATCCTGGATGAGCCCACGAGCGGCCTGGACTCGAGCGCCACGCACAACGTCATGAAGTTCATCGTCAAGCTCTGCGCCGAGGGCAAAACCGTC
GTGTGCACCATCCACCAGCCTTCGTCGCTGGTCTACGACATGTTCACCAACGTCGTGGTGCTGTCGGCCGGCCAGACCGTCTACTGCGGCCCGCGCGGCC
ACGATGATCCCGCACTTTGCGTCGTCCGGCTACGATTGTCCTAACTACATGAACCCGGCCGAGTACTTCATCAGCCTCGTGAACACGGACTTCGACGACC
ACGCGGACGTGCCCAAGCTCGTGCAGGCCTACGCCCAGAGCGAGACCCGCAAGGAGCTGAGCACGCGCATCGAGAGCGACCGCAAGACGCTGCAGCACCT
GCCGGACATCGAGCAGCCGTCGCCCTCGTCTCTGCGGCAGTTCAAGGTGCTCATGTACCGCAACACGCTCAACAACATCCGCAACCCGGGCATCTACTGG
ATCCGCCTCTTCATGTACTTCTGCCTGAGCTTCATGGTGGGGACCATGTACCTGAGCACGAACAACGAGCTGACGGAGGAGGACCTGGTGCCGCTGCTGT
TCTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCCGTGCTGCCCTTCTTCATCGAGCAGCGCGCCGTGTTCGCTCGCGAGCGCGCCAACAGCTCGCT
GAGCGTCGTGAGCTACGTGTGCGCCAACTTCCTGGCGACGCTGCCGGGCATCTTCGTGATCGCGGTCATGTCGACGGCGCTGGTGGTGCTGCTGGCGGGA
CTGAACGCGTTCGAGTACTTCCTGCTCAACCTCTTCCTGTCGCTCGTCGTGTCCGAGTCCATGATGCACGTGATCGGGTCTGCGGTGCCGCACTACATCA
TCGGCATCGCGTTGGGCGCGGGCGTGTTCGGCATGTTCATGCTGTGCGAGGGCTTCATGGTGCCTCGCGCCTCCATCCCGGACTACTGGATCTGGGGCTA
CTACCTGGCGTTCCACTCGTACTCGTTCGAGTCGTTCGTGTTCAAGCAGTTCGAGAACGAGACGTCGGACGCTGCGAAGGCCATTCTGGCCAAGTACGGC
ATGGAGGACGTGGACGTTCCTCGCGACATGCTGTTGTTGGTCGTGTATATTGTTGCGTTCCAGGCCATCTTTGCCTTCATCCTGTGGAAGTTCCACACGG
GACGCCGTTAAGCGAGATAGTTTAGGCAGACAGTATGACTTGGCATCAATAGTCAACCAATATACGTAAGATATACTCTAGCTAACGTGGATATTGTAAG
ATCAAAAATCATGAGTTTGCTAATGAAACTTTATCCTGAAAGGAAGCAAAGGGCGTCTACAGATGCCGACTCAGATGTCCGGTAGTTGATGTGATGTCTT
TCATAGACGGGTGAGCATTCGCCTGGCCATTAGTGCGCTGATGGTGGCAGAGCGCTACACATGTAATGCCTGAGGGCAAAGGAGAATGAACTCGGTGAGC
TCGATGAACTCATGGCAAGACTAGCGAACTTTGCCACTATGACAAGCCTACGACTACTATAATGTAAACTATTGGTCACAACACAAAAGCCAGTCGACTG
TCGAGCCGGTGGTTTAGTCGTGGAGGAATGCCTTCAAGCCTTGAGGGGATCGACAGCAAGTTGCGGTCCGCAACCCAGCGACGATGACGGGCCCGTCACC
TGAAAAGCACGATCGATTTGCACGTTTCCCAAACGAGGGAAAGGCTTGAACGTATCCCGGCACAAACCCAATTGAGCTCAAGTGAAGCACGGGTTCTCTC
GTCCCACATCGAGAGAAGGTTTAGGGAGATCTTAGGATGAGGACGTAGAGGACAACCTCCTCACTTTCGCTGTGAAGCAAATGTATGCTTTCCGTCTAAG
TTTTCAGACGCGCATACGGGTATTGTCACAACTTCAACTTGGCCAGCAATTGACTAAAGAATTCGTATAACAATGCAGATAACCCCCACAAGCTACACTC
GAAATCATTAATATTAAGCAGCAAATAGCAACTCGGTCTCCATACTATTGTAAGCTTAGGCTGTTAACGGCGGCCCGTGTGGAACTTCCACAGGATGAAG
GCAAAGATGGCCTGGAACGCAACAATATACACGACCAACAACAGCATGTCGCGAGGAACGTCCACGTCCTCCATGCCGTACTTGGCCAGAATGGCCTTCG
CAGCGTCCGACGTCTCGTTCTCGAACTGCTTGAACACGAACGACTCGAACGAGTACGAGTGGAACGCCAGGTAGTAGCCCCAGATCCAGTAGTCTGGGAT
GGAGGCGCGAGGCACCATGAAGCCCTCGCACAGCATGAACATGCCGAACACGCCCGCACCCAACGCGATGCCGATGATGTAGTGCGGCACCGCAGACCCG
ATCACGTGCATCATGGACTCGGACACCACAAGCGACAGGAAGAGGTTGAGCAGGAAGTACTCGAACGCGTTCAGTCCCGCCAGCAGCACCACCAACGCCG
TCGACATGACCGCGATCACGAAGATGCCCGGCAGCGTCGCCAGGAAGTTGGCGCACACGTAACTCACGACGCTCAGCGAGCTGTTGGCGCGCTCGCGAGC
GAACACGGCGCGCTGCTCGATGAAGAAGGGCAGCACGGCCACCGACATGAACACCAGGAACGCCTGCACGTAGAACAGCAGCGGCACCAGGTCCTCCTCC
GTTAGCTCGTTGTTCGTGCTCAGGTACATGGTCCCCACCATGAAGCTCAGGCAGAAGTACATGAAGAGGCGGATCCAGTAGATGCCCGGGTTGCGGATGT
TGTTGAGCGTGTTGCGGTACATGAGCACCTTGAACTGCCGCAGAGACGAGGGCGACGGCTGCTCGATGTCCGGCAGGTGCTGCAGCGTCTTGCGGTCGCT
CTCGATGCGCGTGCTCAGCTCCTTGCGGGTCTCGCTCTGGGCGTAGGCCTGCACGAGCTTGGGCACGTCCGCGTGGTCGTCGAAGTCCGTGTTCACGAGG
CTGATGAAGTACTCCGGCCGGGTTCATGTAGTTAGGACAATCGTAGCCGGACGACGCAAAGTGCGGGATCATCTTGGCTCGAGGGCCGCAGTAGACGGTC
TGGCCGGCCGACAGCACCACGACGTTGGTGAACATGTCGTAGACCAGCGACGAAGGCTGGTGGATGGTGCACACGACGGATTTTCCCTCGGCGCAGAGCT
TGACGATGAACTTCATGACGTTGTGAGCAGCACTGGAGTCCAGGCCGCTCGTGGGCTCGTCCAGGATGAGGATGCTCGGGTTCGACAGCAACTCCATGGC
GATGCTAAGACGGCGCTTCTGGCCGCCCGATAGGCCCTTGCGGAAAATGTCACCCACGAGAGTGTCGCGGGCCGTACCGAGGCCCATGGCGTCCATGACG
TTCTCCACACGCACCTCGATCTCTTGAGACGTGACGGTGCTAGGGAGACTGAGCTTGGCGGCCATCCTCATAGTCTCCACTACCGTGAAAGAGCCCAGCA
ACGTGTCTTCTTGGGCCACGTAGCTGGTCACCGCTCGGAACGTCTTGGGGTCTCTCTCGGCGCCGTTCACTTCAATGGCTCCAGACACGTCGCCGGAGCT
GATCCGATCGGCCAACAGGTCCACGAGGGTGGTTTTGCCCGATCCGGAAGGCCCCAGGATGGCCGTGAGCTCTCCGGGGGCACAGCGTCCACTGACTCGG
TCCAGGATGGTCTTGGTGCCCCACGGCAGCTCCGGCGTCTTCTTGCCTTTGACCGTGTAGCTCAAGTCGCTCCAGCTCAGCACGCACGGGTTCCGGATGC
GCTCGTACTTGATCTCGATTTCGCGGTCATAGATACTGGGGACTCGACCGCGAGGTTTCTCGGACGGAGTGGCCATCAATCCAGCGTGGCTGCTCTCCTG
GCTGTGGTCGCTCTCGAGTATCGCGTACCCTCGCGGCGATATCGACGCCATTGCCGCAAACGTGGTAAATTCACGAATGAACTTGAGACCGGATGGGACG
AGGGGGCTATCCAGGTTCGCAAGGGATTCTGCCGGCTTTGGGATACGCTTCATCGTCTCACACTGCTGCAGGAAACGCTAGGTGGAGTCATCGAGCGACG
CCTTTTCTGGCAGAGATTGAAGCGGCCGAGCATTGACGAGACGTCCGAGTCACGTCGTGAGACTGACACAGGTGGGAGCGAGGCTATCGCGAAGATGTGA
CCGCCGTTCCGCTGCTAAAAGCTCAGAGGACAACGGTCAGGCGTAGCGAGTCCCGCGTGGGCTCGAGAGGAGCCTTTACATGGCACTCGCACGCTCGTTC
ATAAGTTTGCTCGTGCATACGCCTTCTGTCAATTTATCAGGGCGATTGCGGGCTATGTTGACGAGCTGTACCAACAACAACGTGCGTGCCACAAGATGAA
TCACTTAGTTTTGTATGTAGCCTATTTGTCGATTTTTCTCTATCAACAATGTCAGGAGGGGGTGGACCCCAACACGCTCGGCAAGCCGAAACAACGTCTG
CGGTTTAAGATCCGAGCATGGTCGCATTGATCGGCTTAGGGTTCTGTCACCGTGAGGGCCCGATATTTGTGCTTTGTAGCGAGATGCCATCCGTTTTTCA
TGTTGTGGCAGTATTCTCTGCCTTACAGAATTCGTTTATTGATACGTTTAGTTGCTTACATTTCAGCGACGACCGGTGTGGTATTTCCACAGGATAAACA
TGAAAATGATTTGGAAGCCCACGATGTAGGCTGCAAGATACAGCATGTCCTGCATGACGTCCACATTCTCCATGCCGTACTTGGCCAGAATGGCCTTCGC
AGCGTCCGACGTCTCGTTCTCGAACTGCTTGAACACGAACGACTCGAACGAGTACGAGTGGAACGCCAGGTAGTAGCCCCAGATCCAGTAGTCTGGGATG
GAGGCGCGAGGCACCATGAAACCCTCGCACAGCATGAACATGCCGAACACGCCCGCACCCAACGCGATGCCGATGATGTAGTGCGGCACCGCAGACCCGA
TCACGTGCATCATGGACTCGGACACCACAAGCGACAGGAAGAGGTTGAGCAGGAAGTACTCGAACGCGTTCAGTCCCGCCAGCAGCACCACCAGCGCCGT
CGACATGACCGCGATCACGAAGATGCCCGGCAGCGTCGCCAGGAAGTTGGCGCACACGTAGCTCACGACGCTCAGCGAGCTGTTGGCGCGCTCGCGAGCG
AACACGGCGCGCTGCTCGATGAAGAAGGGCAGCACGGCCACCGACATGAACACCAGGAACGCCTGCACGTAGAACAGCAGCGGCACCAGGTCCTCCTCCG
TCAGCTCGTTGTTCGTGCTCAGGTACATGGTCCCCACCATGAAGCTCAGGCAGAAGTACATGAAGAGGCGGATCCAGTAGATGCCCGGGTTGCGGATGTT
GTTGAGCGTGTTGCGGTACATGAGCACCTTGAACTGCCGCATAGCGGACGAAGGTCTGAGCTCGATGTCCGGCAGAGACTGCAGCGTGACTCGATCCGCC
GAGAGCTGGTCCAGTAGCTGTTTCTTGACGTTGCTCTGGGCGTAGGCGTAGACCAACTTGGTGATGTCCACGTGGTCTTCAAAGTCCGTGTTCACGAGGT
TCACAAAGTACTCGGCCGGGTTCATGTACTTGGGGCAGGAGAAGCCAATGGATGCAAAGTGCGGGATCATGTTGGGCCGCGAGCCGCAGTACACGGTCTG
GCCTCCCGAGAGCACAATCACATTCGTGAACATGTCGTAGACCAACGACGAAGGCTGGTGGATCGTGCACATGACGTTCTTGCCTTCCCCGCATAATTTG
AGGATATACTTCATGACATTGTGGGCGGAGCTGGAGTCGAGGCCGCTGGTAGGTTCGTCGAGGATCAGGATGCTGGGGTTCGACAGCAACTCGATGGCGA
TGCTAAGACGCCGCTTCTGGCCGCCCGATAGCCCCTTGCGGAAAATGTCGCCCACCAACGTATTCCGGCAGGCTGCGAGGCCCATTGCGTCCATGACGCT
CTCCACGCGCGAGTGGATGTCTGTCATCACGACGCTGTTCGGCAGACTGAGCTTGGCCGCCATCTTCATGGTCTCCACAACGGTAAACGACCCGAGCAGC
GTGTCTTCCTGGGCCACATAGCTCGTCACGGCGCGAAACGTCTTGGTCACGCGGTCGACGCCGTTCAGCTCGATCGTTCCTGTCACGAGGCCCGAGCTGA
TGCGATCGGCCAACAGGTCGACGAGTGTGGTCTTGCCCGAGCCGGAGGGTCCCATGATAGCGGTGAGCTCGCCGGGGGCGCTGCGTCCGCTCACGTTGTC
GAGGATGAGCTTCTTGCCGTACGGGTTCTTGGCCGACTTCTGGCCTGGCACAGCGTAGCTCAGGTCGGTCCAGCTGAGCACGCACGGGTTGATGAACTCC
TCGTACTTGGCGGCCACGGCCCGGCAGTGGAGGCTGTTGTCGGCGTTGCTGGAATAGTCCGACGTGCCGTTGGGGATGGTCCGACCGCTTTCGCGAGTGT
ATCCGCTCTTCTCGAGCATGGGCGGCGACAGTTCCGGCAACATGGCGCCGAAGGGTACCGCGGGTGAAGACGCCATTGGGGTCTTCGTTCGCGTCCTATT
TCAAAGTGGCGGATTGACAGCGGCAGGGTCTCGACCGACTGCGCATTGGCATTGGCACCACCGCCTTTCCATCGGACTGTAGAGATGGAGCGTCGATCAC
CTGCCGAGGCAGGTCAGGCACACGGCGCAACGCGGCGACAGCGGGCGGACGAGCGACACGACAGACATGCCAGCTGAAAGCGCAAATCGGCCAGGAAATT
CCTGCCACGCTGCTTGTTTTGTCATGTTTGAACTTGTCGGCGCCGTCGGCAGTAAACAGCCGCGTACGCTTAGCTGGAGTGGACGCCCGTCGCTACGGCA
TCTAGCAGTCCTCCTCGAGGCTGGTTCCAGACATTCTCTTCTGGTATAGGACGGCTTGACCAATTATCACCCGAACGACCTGCATAAGAACACTCGCCTC
GCAGTCTTGTGGAGTGACCTGGGGTGGTACACCGAAAGTGTTGTTAGGCAGCAAGTTATTATTTGCTCAGCCTGGTAGTTGCCAGCCTCCGTGTGATGAT
CCTGTTGTTCGCAATGGTTTCTGCTGAGTGGCTCGTAACAAACTACGTGTCTCCCCTACTGTTGCAAGTCTCTTGAACTACCGTTCAAATGGGGAGCTCG
ACAAGACTTTAGACGGTGAGCTCCTGGATCTTGGGCGTGTCGTCCTCGTCCTCCTCGAAGCGGCCGCGCTTGGCCATGTAGTCGTGGAAGGCCATGGAGC
CCAGCAGTAGGACCGCCACGGCGGCCTGGCCGTAGATGCGCGTGTGCATGATCTGCTGCGAGCGATTGATGCCGTGGTTCGTGGTCTGATAGGCGAAGAT
GCTGCCCACGAGAGGGACCCCCACGGTGGTCAAGCTGCGGTACGGGTGATCGTACACAAAGTTGGCTGCTCGTTTGTGCAGGGGCAAGTGGCTCGTCACC
CTGCGGACTTCGACGAAGCTCGGGTCGAGCGAGGCCATGTACTGCTCGGGGTTCCTGGCCCCAACCAGCAGGCGGTTCTCGGCCACGATGGCGAACCCGG
CCAGGTAGGCCGAGACCACGAGCGCCCACTTGCCGCTGACGCCGAGGCGTGTGCGGAAGCCGCGGTGGTACGCGTTGGCGCCGTAGACGGCCGCGCCCAT
GGCCAGACTGGCCCAGGCGCCGGCCTTCAGGCCGCTGACGTAGGCGTCCCTGGAGATGGCATCTTTGTGGCGCTTGGCCTCGTCGAAGTCGTGTGCGGAC
TTGTGCATGGCTGGAGGGGGGAGAAGGCGACTTGGGTGGACGCTGGTCGATTGAGGAATGGCCCGAAGCTATGAGCGGAGACCACTGGAATCCTCTGTAT
AAAAACTGCAGACCAGTACGCTTCGCACTCTTGTTGTGGGGTCAGGCAGCGGTGGTGGGTATGCAAAACGTAAGGCTCACGTTGAAGCAGGTCAGGCATA
GCGTTCCCTCCACCACCGGCATGATTTTTAGACTTTCGGGTTAAGATTTGAAAACTCGCCGGACGCTCAGTCTTCGAGATGACGTTCGTGACAGGCTTTG
GCGTCTTGGCATACCCGCAAGGCGGCCATCTCATGGGAAGAGGACGCTCGCAGAGAAGGAGGCTCGGACAGTTCGGCAGGAGAGAACGTCCTGCACTCGA
TAATCTGCTGTCTGACTGTGCCGCGGGGTTTCTTGATTTCTGTAGTACTACAAGAGGAAGCCCTGCTGCTGCAAGAATGGAGTGCATCAGTGGCGGTCGT
GAACACGCGAAGCTCAAGACGAAAGGTTTACACTCAAAAGAAGCGCCAGCTTGTCCTGGCCAAGCGTGGGCGGCACAACAATGGGACATTGTGTGTGGAG
CTTCTTGTTTCACGGCCGCTATGGAGGCGGTTGGCGCGCTCCTCCTATTTGACATTGGCACAGTTCGTTGGCCGCAACTCGGTCGTGTTTGTCGGCAATC
TGCACTTCGGAGAATACCAAAGTAGCCCACAGTTCAAGGGGAACTCATTTGCCAGACGCCTCTGTACTGCATGTACTCCGCTCCTCACTAAAAACACCTA
GACTATGCTAACTACAAGGTCAGATTCGCTACGCTCTTTCGCCACAATCACTGCCGTAGTCGCCAACTGCATCAGCAACGGAGCTGGAGCTGCTACTGGC
TGTGTCATCGAACATCAGCATCTGCACGTCCAGCGCTTCTTGGAGATGGCTCACATACTCGAAGTTTGCCTTGCAGTCCAACGAACAGAATCTCCCTGCA
CTGCCGCTGACTGTCGACAAGAACGTGGGGAAGAGGCGCTCGCAATTGATGCAGTGCGCTTGTCGCCGTCGCCAGTTGACTTGACTATCGCTTCGATAGC
GCTCCTGCCGAGCTCGAACGTGTCTTGAAGCCGGTAGAGTGGACGGCACCGACGAGGAGCCGAAGCTGTGCGGGATGCGGATGTTTGCGCTGGATGGGGG
ACTGGCGCTTGTCGGCACAGGCAGAGACTCTGTGCGTCCTGGCCACGACTTGGATCGATGGTCTGCGGTGCGTCGTCTTCTCTGGAAGACCAGTTGGAGC
ATCCGTGAGGCGAAGCTCGGACGGGATGCAGTCGCGTGCTCAGCACTGGGTGTCTTGGATGGCAACTCACTCGCACAGACATTTCGAGTGGCCGAGTTGG
GCTGCTGGCGGTCCAGGCGCGAGGCGTACGTCATGATTCTGTGGTCGACTTGCACTTGCTCGCGTGAAGGTGAAACCCAAAGTGAGTGTGGAATTCGGGC
GGTTCATGCTGCCGCTTTCTGTCGTGTTCTCTTGGTCGAATACACTTGTGATCCTGCTGACCTGTCGGGCCTCCTCGCAAGTCGCGACAGTCTGAGCAAA
GAGACCGCGGAGCGAGACGAGGTCAGTGCCGCGAGAGAAATTACAAGTGCCGACGACGAACCAGCCACGCAAAGGCTCGACGTGGCTCTAGGAATTGTCG
GCTGGCACCTGCAGCAGCAAGGTTGTTCTTGCGTGTTGCGCTTGGCGATGGGCTGATAACGAAAAGCTGGGGCTTCACTATGGGGCAGCCCCACGAAACA
AGCAACGCACGTGGAAACGCAGCCGAGCCGATGACTCATAAAGGTACACTTGAAGCTGGATGGCCTTCGGACCGCCGCGTCGCAAACGGCAACGCATGCC
GCGTAGCTGTTGACTCAGCGTGGAGTTCCGCTCGGTGTCTTTGCGGCAAGGACTTGGGACCGAGTGTTGGTGTCGGAAGGATTAGCCCTGGCGAATGTGG
TGGACTTCTGAGAACAAAGCCACCGACCGAGCCTGTGTATGGGAAGAGGAGTCGAATGAGGCGGTTCTTCAGGCAAGATGAGTCAAGTTGGCACTTGCAC
AACGTGCTGGCTGAAGACGTGAGCGGAATTCCGTCAGCAAGAACTGGGCCAGGAGAAAATGTTACTGAGGCCTGGTGATAGACAATCGGGACGGCTGCAT
GTACAGCAACAAGACTACGACACTGGCACATTTTCGAGACTTGCTTTGGAAAGCGCGCTACTGCAACGGACATTATGGACGTCACCTGTACTTTGAAGCA
CCTGGGCAAGAAACTGGAGTGTCTTGGGTACCGCTCACGCTCCCACACAAAACGCTAGCAACTGTACAAGCCTTCGCACTTCTCGGTGAGGTCTTTGCTG
CGTACATCTCGATAATGGTCTATCGTGCGTGGCGGGCCGACGAAGGCTGAGGCAAGGTACACGAACAAGGACTCGAAAGCTACAGTGGCTTAGAAACTAA
TGCAATCATCTCCATTCAGATTCGATCCAGCGAACTGATGTTGCAGATAGCACCAATCTCCTCCTGGAAATGACTCACGTACTGGAAGTTGGTTCTGCCG
TCCAACGAGCAGAATCACGAGGATCAACGAAGCGCAGGCGGTCAGAGTTTATACTGTGAATTGGCTGCTGTCGCCAGGGAGGTTCCTTACAGCAGTCGAG
GCGCTACTACATCTAATATCTTCACGTGAACAGCGTACTTGTCGAGCTTGCATCTGCCTTGAAGTCGGCGAAAAGACCGTCACTGGAGACTCGTCGGTGC
AGGATTGGGGGTTGACGGCCGTCGGAGAAAGAACTTCCAAACTTCCTGGGGCTTCGGTTCTGGAGAATGGTCTCCTCTCTTGAAGACGATCTTGATCATG
CGAGACGCAAAGCTTGGACGGGGTGGGCGTGCGTCTTCGTTATCATACCTCTTGGTTGAAGAGCGTGGTTGCTGAATTCTGGAGAAGACGCGCTGGTTGC
TTGTGAGGAATAGCGCGAAGGACATGCTGGCGGAGTACGAGTGCTCGCTTGAGGGTAAGTTGGAGACTGGGCAGCGCATTCCTGTCATTGTCACTCAGTT
ACTCGACGAATACGTCTGCAACCTTGGTCGAAGGGAGACCACGATGCGGTGTATCTCGGAGCGAGGCAAAGAGACCCGAACCATGACTACGGTAGGGCAA
CTCAGACCCTGGATGCTTGCGAGTCATTGTATGGGCGCGTGGATATGCAACCAACCCGATGACTCAATCGTTCTGCATTGGTTTGGGAAGAGGTTCGGCT
GACTCAGATTGACGCTTGTCAATAGCCAAGAGGGAATTCCGGTGCCTTCTCCATGCGGGTTCGTCTCGAAGATCGGTTTCGAGTCTTACGTATCAAAGTC
GTGCAGCCAAGAGCGATCGAGCAGCGTCGACAGCCCCAGTTTGACTGGGACTGTGTGCTGCGTTCGCCTTCATTATTTCTAAACTGCCAAGCGATTGAAT
TCTACCCGACGACACTATCCCGGTAGCTTATGCTAGCAACAACAGGCACCCTTCAAATTCATTGTGCTCCGTCATCGCACAAGCTGTCGTAGTCGTCATC
CGAAGATGCACTGCCAGAAGCAGTTTGGAGCCCCAGCATCGTCACCTCCTGCAGATGACTCACGTACTCGAAGTTCGTCTTGCAATCCAGCGAGCAAAAT
CTCCCTGCACTGGTACTTAGCGACGCGAAGAAGAGGTGCTCGCAGTTGACGCAGTATGCTTGTCGTTGCCGCCAGCTCGGTTCACTGCTACAGTCGTCGT
TATCCGGCTCATAGCGTACCCGCCGAGCGCTGGTGCGCTTTGCAGCTGCCCATGCCGACTGCAGTGACGACGTAGACTGCAGTGTCGAGGAGCTGAGGCT
GTTCGGAATGCTGATGCTAGTGGTGGATTGGTATTTGACGACCGCCGGCACTGGTGCAGCCAGAGGCTTCGAGCACCCTGGCCACGACTGTGGCTTCTGC
TCGGCGGTGCTTCGTCCTCTCTGGAATAGCAGCTGGACCACGCGCGAGGCGAGGCTCGGACGTGAAGCAATTACATGTTCGGCACTTCCAGGTTTGGTCG
AGGAGCTTGGGCTGCTGACCTCTCGAGATGCAGCATTGGACTGGTTCTTGAGAAGGCGTACATTCATGAAAATCATTGCTTGTGGCGTAAAAGTCGAAGT
CAGAAGTGAGGTGCTCTCCGTCGAGGTTTCCTGCCACGCTTCCACATTCCGACCGAATACGCTTGTGATCTTGGCGGCTTGCCTCGCCTACCGCAGCAGA
TCAACGGAGTCGACTGCGAAAGCGACAAGGTGTGTACCCTAGAGAAGGGGCGCTTGAAATCGTAAGTGAATCCGTTCAACACCAACGTGGGGCTTGACAT
TGTCTTCAAACAGCTGCAGTGGCGACGTTGTATTCCAGCTTTGTTGTTCGCAGTCTTGCATACAGGTTGTAGTGACCTGATAATTAGCAGCGAAGCGAGA
AGTCAGGACAACGCACGCGTGGAAACGCAGCCTGCTTGCCGATCCACCGATCCAGGGAACACTTGAAACTGGGTTGCCTTCCGAAGAGCTGGTGATAACT
CTGTTGTAAGTATCGCTGGGACCAGGCAATGCTGTTGACCATCGCAGTCGATGGACCTGGCACGCGGAGCAAATGGCGTGAGAGAACGAGAAAATGCTTG
CTACTCGTTCCCCTTCGCAAGACCTTCCTCCACGCGACATACACTTGAGTTTCCGTGCTACAACGAGAGCGCTCGAATTGATTCCTGGATCTACATGTAG
TGCAGAGATCGGAATGTCCGTCACTTGGGCATTAAGTGGGTCGTGTTATTTTGTTAGTTTACTCTTCCAACGGGGTTAGTTTGATATGCACCGATAAAAA
TGTACATGCAAATATTGATACGGAGGACGGAATCACGTACTCGTGGCGAGATTTCTGTGGGTGGGATTCCGTCACAGCACTGCTGCGGTAGCAGAATGGC
GGTAGGTGAGTTGATGCGGAGGTCGAGGCGGGTGTTGCACGCGGCGGCGGTGGCTCGCACTCGTGTCGGCGTGTTCTTCATCCTCGAGCACCGAGCGAAC
ATTCTTCAAGCGCTGTTCGAGCGCGCGCAGGAAAGTGTTCACATTCTTTTGGTCATCCACAGCTAGCGCACCAGCGCCAGCGCCTCCTTGTGCACCAGGT
GTATCCATAAGTAAGCTCTCTAACAGGAGGAGGGCCTGCAGGTAGTGGTCGTGTGCAGCGCGGGTGTGGCCCAAGACTTCACGAATAGCACCCTGGCGAC
CAATTCGAAGAGCGTGAGCGTACAAAAGCTCTTCCTGCGACGCGATGGGTCGAGGCGAAGTTTGAAGGCGTGCAGCACGGGCCATGCGCGCCTTGCACTG
CTCCGCACGATCCAAGAAATGTGTCAGTTGTTCCGACAGGAAAGCCATCGACACCTTCCGGTTTGTTTCACTCCAACCAGGCGCCACTCCTGATGATGAT
CCAGACGATGATCCCATAGAGCCTCGGGATTGGGCAAACGCCGGATCTTGGCGCAAATACAAAACAACATGCTGAACCAAGCGAAGACACTTCACGTATA
GCGCCAGCGCCTCAGCAGCACACACATACTGCCGTTCGGCAGTGCGCTTGTCGTCACTGTCCTCGTCATCGTCTTCAAAATCGCCGTATTCGTCATCTCC
AATCGTATTGCTCACACCAACCGATGACGCCAACGACGAACTCATCGAAAACACAGACGAGAAGTTCACGCCACTAGCTCGTTTGCCACCGGACGTTGAC
AGTGTTGAAGTTTCCACAACTGTTTGCTGTGGTGACCAGTCCTCCCGCGTTGGTTCGCCATTATTCTCAGTCTCAGAACCCGGCACTGCGTCACCAGCGG
CGCTCAACGTCCAGAGCTGGTCGGCAATTGGAGCGATGGCTTGAGTACGGAGAACCACAATGTCGATCAGTTGTTGACCGTACTCACGAGAGAATGTTTC
AACAGAATTTCCACTGTTGGAAGTCAACGCTCTCATCTTCATATCGTGGGTCGTCACCCCACTGGTCGGTTCGTGGGCTACGTCGGAGCGAGCAGTCAGA
GGTGTAGGTTGTCTCTCCGGCAGGCCGTCTACCAGCACGTACTCGCCGCTGCTATCCAAAGCAGGGCCACCACCGCCAGAGATCTTCTGCCTCGTTGTCA
CGATTGCATCGCTGCTTCCCGATTGAGAAGTTGAAGGGTTCTTGATCCGAGATGATCCAGATAACGAATGCTGTTGAAGTGCAGCGGCGCCAGGGGGCGA
CTCTGACAGCTGCTTGAACGGGTTGATTCGTGGGCTGGGGCTGGGACTGGGTAGCACATGCGGGCTCATCTGAGGGCTGAGCTTCGGACTCGTTCCTGCA
GCACCTAGTGCAAAGCCACTTCCACTCGACGTAGCACGCCGGCTT